Http://www.abbs.info e-mail:[email protected]

ISSN 0582-9879                 ACTA BIOCHIMICA et BIOPHYSICA SINICA 2001, 33(1): 25-29                   CN 31-1300/Q

 

Hammerhead Ribozymes Suppress HBV(adr) in HepG2 Cells

ZHENG Wen-Chao*, LU Chang-De, KONG Yu-Ying, WANG Yuan, QI Guo-Rong**

( Shanghai Institute of Biochemistry, the Chinese Academy of Sciences, Shanghai, 200031 )

 

Abstract        Three hammerhead ribozymes (RS3, RC2 and RC1) targeting to the HBV genome have been designed. Plasmids were constructed by inserting the genes of naked and tRNA-embedded ribozymes into RNA trimming vector pRG523 and then were transferred to eukaryotic expression vector. By the similar cloning method the shotgun-type plasmids carrying homogeneous RS3 or RtS3 unit-connected in tandem were obtained. After co-transfecting the above plasmids and HBV genome-containing plasmid into human hepatoma cell line HepG2 respectively and selection by G418, the HBV-inhibiting activity of different kinds of ribozyme in G418-resistant cells was achieved by measuring the decrease of HBV-RNA, progeny DNA and the antigens expressed. The results showed that all the ribozymes were active with more than 70% inhibition activity against the HBV and that tRNA-embedded ribozymes had higher activity than naked ribozymes. It is worth particular interest that shotgun-type ribozymes with the connected unit in tandem with 8 and 12 units constructed in the plasmid revealed the highest activity, reaching >90% inhibition.

Key words    hammerhead ribozyme; HBV; HepG2 cells

 

HBV is a small spherical hepatotropic DNA virus, causing not only acute and chronic B-type hepatitis but also hepatocellular carcinoma. It is widely distributed throughout the world. There are at least four proteins encoded by the HBV genome: protein S, C, X and a specific DNA polymerase (pol) as shown in Fig.1. HBV replicates asymmetrically through reverse transcription of an intermediate called pre-genome RNA, pgRNA. For targeting the HBV mRNA and pgRNA, a series of nucleic acid agents such as antisense oligonucleotides[1-3] and ribozymes, including both hammerhead[4-7] and hairpin[8] structure, have been designed and used in vitro and/or in vivo, with the attempt to block the expression and replication of HBV, thereby to inhibit and prevent the HBV infection.

In order to compare the anti-HBV activity of different kinds of hammerhead ribozymes(Rz), plasmids, including naked, tRNA-embedded[6,7] or shotgun type ribozymes against HBV DNA (adr) at 3 sites(see Fig.1), were constructed from the trimming plasmid pRG523[10] and co-transfected into HepG2 cells with HBV genome-containing plasmid p1.2 II respectively. The results indicated that the relative amounts of HBV RNA, progeny DNA and antigen proteins to the control were remarkably decreased, among which the activity of tRNA-embedded ribozymes was higher than that of naked ribozymes (see also ref.7) and particularly the shotgun-type ribozymes with unit number connected up to 8 or 12 had the highest activity (>90% inhibition).

 

Fig.1       HBV(adr) genome-containing p1.2 II plasmid and the cut sites of designed ribozymes

(A) the structure of plasmid p1.2 II, the HBV(adr)[9] genome is in the box, the arrows show the position of the sites as in the mRNAs or pgRNA cut by designed ribozymes (RS3, RC2, RC1 and RtS3, RtC2, RtC1). (B) HBV genes: Gene C expresses both antigen C (HBcAg) and antigen e (HBeAg); Gene S, Gene X and Gene P express HBsAg, protein X and a specific polymerase respectively.

 

1    Materials and Methods

Three ribozymes RS3, RC2 and RC1 against HBV(adr) shown in Fig.1 were designed with the computer analysis[11]. The tRNA-embedded ribo-zymes, RtS3, RtC2 and RtC1, were obtained by inserting the above ribozymes into the anticodon of a modified human tRNAMet (see ref.6) respectively. All the synthetic ribozyme fragments were cloned into pRG523[10] by means of appropriate restriction enzymes. The resulting plasmids were denoted as pTRS3, pTRC2 and pTRC1 as well as pTRtS3, pTRtC2 and pTRtC1[6]. With the similar cloning method, the plasmids carrying homogeneous unit-connected ribozymes pT2RS3 (n=2), pT4RS3 (n=4), pT8RS3 (n=8), pT12RS3 (n=12) and pT12RtS3 (n=12) were also obtained (Fig.2). These plasmids were linearized and transcribed by T7 RNA polymerase, and the active trans-ribozymes can be produced in vitro (data not shown). All the above plasmids were transferred into a plasmid which possesses human cytomegalovirus (hCMV) promoter and neomycin resistance gene (Neo) driven by thymidine kinase (TK) promoter and a set of ribozyme genes-containing eukaryotic expression plasmids was obtained (Fig.2). The prefix in the name of those produced plasmids is changed to pC from pT counterpart, e.g. pTRS3 to pCRS3, pTRtS3 to pCRtS3 and so on. Control plasmids are named as pCR53 and pCRt, in which the whole ribozyme sequences are deleted.

 

Fig.2       Part of organization of ribozyme expression plasmids

*, active center sequence: CUGAUGAGUCCGUGAGGACGAA[12]; **, embedded tRNA: modified human tRNAMet(see ref.6).

 

HepG2 cells were propagated in DMEM (Gibco-BRL) containing 10% fetal bovine serum, 100 units/ml penicillin, 100 mg/L streptomycin and 2 mmol/L l-glutamine at 37 ºC and 5% CO2. The cells were plates in a 6-well plated (3.5´106 cell per well) 18-24 h prior to transfection. Transfection was achieved with 7.5 ml Lipofectin reagent (1 g/L), 1 mg of p1.2 II and 0.05 mg ribozyme expression plasmid according to the protocol of supplier (Gibco-BRL). Selection for neomycin resistance was done with G418 (geneticin, Sigma) at concentration of 400 mg/L DMEM. Two weeks after transfection, colonies from each transfection were harvested with trypsin, mixed and then expanded up to >107 cells for analysis.

Dot blotting, Southern blotting and RNase protection assay were done according to the standard procedures[13]. Labeled antisense probes of HBV and b-actin RNAs were transcribed from corresponding plasmids after linearization in vitro[7]. 3.8 kb HBV DNA probe was prepared from p1.2 II by a random primed method. 200 mg total RNA prepared from transfected cells was used for dot blotting while progeny DNA prepared from 1×106 transfected cells was used for Southern blotting. 2´106 cells were seeded in 23 cm2-tissue culture plate in 5 ml of DMEM supplemented with 10% FBS for enzyme-linked immunosorbent assay (ELISA) of HBsAg, HBeAg and HBeAg/HBcAg was carried out by using the protocol of commercial kits (KeHua Co, China).

2    Results and Discussion

Human hepatoma cell line HepG2, shown to be competent for HBV replication after transfection with cloned HBV DNA, can maintain high levels of expression of HBV genes and produce infectious HBV after transfection with closed circular HBV DNA[14], which implicates that HepG2 cells are suitable to be used in studying the anti-HBV effect of ribozymes in human cells. Ribozyme genes under the control of hCMV promoter were linked with TK-Neo gene in the plasmid, so almost every G418 resistant cell contained ribozyme gene after selection once or more times if necessary. Most resistant cells also contain HBV (3.8 kb) sequence after co-transfection. Southern blotting demonstrated that average copies of 3.8 kb per cell ranged 0.78-0.88 or 0.81-0.91 among G418 resistant cells (data not shown). The difference is quite slight and it reveals that the results shown in Fig.3 are mainly caused by ribozyme-mediated cleavage, not from transfection discrepancies. Similar evidence came from the small RNAs of total RNAs extracted from G418 resistant cells: the small RNA contained in vitro ribozyme cleavage activity targeting the corresponding substrates (unpublished data, see also references 16 and 18).

 

Fig.3       Decrease of HBV-RNA (A) and progeny DNA (B) in the G418-resistant HepG2 cells after treatment with shotgun-type hammerhead ribozymes

(A) HBV-RNA detected by RNase-protection method using b-actin mRNA as control (nt, nucleotide residue). (B) Progeny DNA identified by Southern blotting method.

 

The HBV-inhibiting activity of different kinds of ribozymes in HepG2 cells with three aspects: decrease of HBV RNA, inhibition of progeny DNA synthesis and reduction of HBV antigens is shown in Fig.3 and Fig.4. The results of the HBV RNA decrease and inhibition of progeny DNA synthesis in the G418-resistant HepG2 cell line after treatment with the shotgun-type hammerhead ribozymes are shown in Fig.3. The relative amounts of HBV-RNA, progeny DNA (data from Fig.3 of this paper and Ref.7) and antigens detected by ELISA method are shown in Fig.4. The combined results indicated: (1) all the ribozymes designed and expressed are active in transfected cells with >70% inhibition activity in comparison with none ribozyme sequence control, (2) the HBV-inhibiting activity of tRNA-embedded ribozymes is higher than that of naked ribozymes by about 10%-30%, and (3) the shotgun-type expression system is obviously effective to inhibit the HBV in HepG2 cells. The extent of the effectiveness depends on the linked number connected in tandem of the plasmids: the larger the number, the higher the activity. When the number is linked up to 8 or 12, the HBV-inhibiting activity reach >90% inhibition (see 8RS3 or 12RS3 in Fig.3).

 

Fig.4       The relative amounts of HBV-RNA, progeny DNA and antigens in the G418-resistant HepG2 cells

The amount of HBsAg in supernatant detected only when ribozymes RS3 and RtS3 cut in the surface antigen region were used (see Fig.1) and the amount of HBeAg in supernatant or HBeAg/HBcAg in cell lysate detected when ribozymes. RC1, RtC1 and RC2 cut in the core antigens region were used (see Fig.1).

 

In conclusion, our results indicated that the shotgun-type ribozymes with more than 8 connected units (Fig.2, n=8 or 12) were the best for inhibiting expression and replication of HBV genes in stable, long-term system in comparison with other type of ribozymes. It must be mentioned that in this study non-toxicity for the HepG2 cells lasted for several months (data not shown).

For eliminating the effect of non-pairing extra flanking sequences on the ribozyme and target RNA, the RNA trimming vector[10,15] has been used to construct trans ribozyme-containing plasmids. All the plasmids constructed here were cloned into the trimming vector pRG523[10]. This effective maternal plasmid prepared in our lab has high self-cleavage activity, thus trans ribozyme can be released easily. By means of the pRG523, a series of studies of hammerhead ribozymes against viruses, including HPV (human papilloma virus)[16], HAV (hepatitis A virus)[17], NPV (nuclear polyhedrosis virus)[18], and also mRNAs, including ADA (adenosine dea-minase)[19], PCNA (proliferating cell nuclear antigen, cyclin)[20], MDR (multidrug resistance)[21] mRNA, in vitro and in vivo has been performed in our lab.

In the published works the mutantly disabled or crippled ribozyme were generally used as control for measuring the anti-virus activity of active ribo-zyme[4,5,8]. According to the mode of action[11,22] ribozymes appear to act as both antisense and cleavage function. In general, under the given conditions ribozyme activity for blocking the gene expression should be higher than that of the antisense oligonucleotide alone. This conclusion proved to be true after we compared the inhibition activity of active and inactive ribozymes in the same system for targeting the PCNA[20] and HPV-16[16] as well as HBV genes in our lab (unpublished data). From a practical point of view, one of the overall strategies is how to combine the advantages of antisense and cleavage function and thus to design and select new ribozyme molecules.

 

Acknowledgments  We thank Mr.CHEN Nong-An for assistance with the designing of the the ribozymes and Ms.ZUANG Ming for oligonucleotides synthesis.

 

References

1     Offensperger WB, Offensperger S, Walter E, Teubner K, Igloi G, Blum HE, Gerok W. In vivo inhibition of duck hepatitis B virus replication and gene expression by phosphorothioate modified antisense oligodeoxynucleotides. EMBO J, 1993, 12(3): 1257-1262

2    Korba BE, Gerin J L. Antisense oligonucleotides are effective inhibitors of hepatitis B virus replication in vitro. Antiviral Res, 1995, 28(3): 225-242

3     Nakazono K, Ito Y, Wu CH, Wu GY. Inhibition of hepatitis B virus replication by targeted pretreatment of complexed antisense DNA in vitro. Hepatology, 1996, 23(6): 1297-1303

4     Fritz von Weizsacker F, Blum H E, Wands J R. Cleavage of hepatitis B virus RNA by three ribozymes transcribed from a single DNA template. Biochem Biophys Res Commun, 1992, 189(2): 743-748

5     Beck J, Nassal M. Efficient hammerhead ribozyme-mediated cleavage of the structured hepatitis B virus encapsidation signal in vitro and in cell extract, but not in intact cells. Nucleic Acids Res, 1995, 23(24): 4954-4962

6     Zheng W, Qi GR. tRNA-embedded hammerhead ribozymes mediate destruction of HBV(subtype adr) in vitro. Acta Biochimica et Biophysica Sinica, 1998, 30(5): 432-438

7     Zheng W, Qi GR. Anti-HBV activity of tRNA-embedded ribozymes in HepG2 cells. Chinese Journal of Biochemistry and Molecular Biology, 1999, 15(4): 563-567

8     Welch P J, Tritz R, Yei S, Barber J, Yu M. Intracellular application of hairpin ribozyme genes against hepatitis B virus. Gene Therapy, 1997, 4(7): 736-743

9 Wang Y, Li Z P. Hepatitis B virus genome: Structure and function. In: Wen Y M, Xu Z Y, Melnick J L eds. Viral Hepatitis in China: Probloms and Control Strategies. Monographs Virology, Basel: Karger Press, 1992, 19: 1-19

10    He YK, Lu CD, Qi GR. In vitro cleavage of HPV 16 E6 and E7 fragments by synthetic ribozymes and transcribed ribozymes from RNA-trimming plasmid. FEBS Lett, 1993, 322(1): 21-24

11    Lu CD, Chen NA, Qi GR. Computer analysis of the cleavage reaction of hammerhead ribozyme. Acta Biochimica Biophysica Sinica, 1996, 28(3): 279-285

12    Hertel KJ et al. Numbering system for the hammerhead. Nucleic Acids Res, 1992, 20(12): 3252

13    Shambrook J, Fritsch EF, Mannitis T. Molecular Cloning: A Laboratory Manual, 2nd ed, New York: Cold Spring Harbor Lab Press, 1989

14    Chang C et al. Production of hepatitis B virus in vitro by transient expression of cloned HBV DNA in a hepatoma cell line. EMBO J, 1987, 6(3): 675-680

15    Taira K, Nakagawa K, Nishikawa S, Furukawa K. Construction of a novel RNA-transcript-trimming plasmid which can be used both in vitro in place of run-off and (G)-free transcriptions and in vivo as multi-sequences transcription vectors. Nucleic Acids Res, 1991, 19(19): 5125-5130

16    Huang YZ, Kong YY, Wang Y, Qi GR, Lu CD. Stable expression of anti-HPV 16 E7 ribozyme in CV-1 cell line. Chinese Journal of Biotechnology, 1996, 12(4): 385-389

17    Jin ZY, Lu CD, Li GD, Qi GR. Design and properties of ribozyme for site-specific cleavage of RNA fragment derived from hepatitis A virus. Chinese Journal of Virology, 1993, 9(1): 1-6

18    Zhang XL, Zhang F, Qi GR, Lu CD. The protection of B. mori cells by ribozyme upon NPV-infection. High Technology letters, 1997, 7(4): 23-27

19    Chen H, Lu C D, Qi G R. Co-cleavage of the murine adenosine deaminase mRNA with mixed ribozymes. Acta Biochimica Biophysica Sinica, 1994, 26(6): 603-606

20    Jin Z Y, Qi G R, Lu C D. Effect of inhibition of expression PCNA with ribozyme on the proliferation of cells. Acta Biologiae experimentalis Sinica, 1996, 29(4): 351-356

21    Yuan YW, Zhang JR, Qi GR, Lu CD. The reversion of multidrug resistance in tumour cell line MCF-7/Adr by ribozyme. National Medical Journal of China, 1997, 77(7): 494-496

22    Perreault JP, Labuda D, Usman N, Yang JH, Cedergren R. Relationship between 2'- hydroxyls and magnesium binding in the hammerhead RNA domain: A model for ribozyme catalysis. Biochemistry, 1991, 30(16): 4020-4025

Received: July 11, 2000         Accepted: August 18, 2000

This work was supported by the State 863 High Technology R & D Project of China (863-102-18-47) and the National Nature Science Foundation of China (No. 29632060)

*Current address: Department of Pharmacology, Medical School, University of Wisconsin 1300 University Avenue, Madison, WI 53706, USA

**Corresponding author: Tel, 86-21-64374430; Fax, 86-21-64338357; e-mail, [email protected]