Original Paper

Pdf file on Oxford OPEN

I want to comment Other comments

Acta Biochim Biophys Sin 2009, 41: 594602

doi: 10.1093/abbs/gmp047.

Functional analysis of ScSwi1 and CaSwi1 in invasive and pseudohyphal growth of Saccharomyces cerevisiae

 

Xuming Mao1,2, Xinyi Nie2, Fang Cao2, and Jiangye Chen2*

 

1Institute of Biochemistry, Zhejiang University, Hangzhou 310058, China

2State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences,

Chinese Academy of Sciences, Shanghai 200031, China

*Correspondence address. Tel: +86-21-54921251; Fax: +86-21-54921011; E-mail: jychen@sibs.ac.cn

 

Here we reported that, in Saccharomyces cerevisiae, deleting Swi1 (ScSwi1), a core component in Swi/Snf complex, caused defects of invasive growth, pseudohyphal growth, FLO11 expression, and proper cell separation. Re-introduction of SWI1 into the swi1 mutants could suppress all defects observed. We also showed that overproducing Swi1 could suppress the defect of flo8 cells in pseudohyphal growth in diploids, but not invasive growth in haploids. Overexpression of SWI1 could not bypass the requirement of Ste12 or Tec1 in invasive growth or pseudohyphal growth. We concluded that the Swi/Snf complex was required for FLO11 expression and proper cell separation, and both the FLO8 and STE12 genes should be present for the complex to function for the invasive growth but only the STE12 gene was required for the pseudohyphal growth. Ectopic expression of Candida albicans SWI1 (CaSWI1) could partially complement the defects examined of haploid Scswi1 mutants, but failed to complement the defects examined of diploid Scswi1/ Scswi1 mutants. Overexpressing CaSwi1 mitigated invasive and pseudohyphal growth defects resulting from deletions in the MAP kinase and cAMP pathways. The integrity of S. cerevisiae Swi/Snf complex is required for invasive and filamentous growth promoted by overexpressing CaSwi1.

 

Keywords ScSwi1; CaSwi1; invasive growth; pseudohyphal growth; FLO11; Saccharomyces

cerevisiae

 

Received: December 5, 2008 Accepted: March 19, 2009

 

Introduction

 

Saccharomyces cerevisiae is one of the dimorphic fungi, which shows invasive growth, pseudohyphal growth (collectively referred to as filamentous growth) and yeast growth. MAPK and cAMP/PKA pathways have been well characterized required for invasive growth of haploid cells and pseudohyphal growth diploid cells. Ste12/Tec1, transcription factors of conserved MAPK pathway, binds cooperatively to consensus filamentous responsive elements of target genes, and Flo8 is a transcription factor downstream of cAMP/PKA pathway, whereas Phd1 modulates filaments independently of MAPK or cAMP/PKA pathway, and all these signaling converge on a unique target gene, FLO11 [1]. Swi/Snf complex is a global conserved regulator by repositioning nucleosomes to remodel chromatin in an ATP-dependent manner [2,3]. In S. cerevisiae, Swi/Snf complex has been shown to play vital roles in transcription initiation (activation and repression), transcription elongation, damage-induced DNA repair, DNA replication, and heat shock responses, etc [2,48]. In mammalian cells, altered activity of Swi/Snf complex correlated to cell morphology in tumor development. Expression of BRG1, a core component of human Swi/Snf complex with ATPase activity, promoted filamentation of actin in BRG1-deficient cells [9], and expression of ATPase-deficient BRG1 enhanced attachment of cells to extracellular matrix [10]. However, re-introduction of SNF5, also a core member of Swi/Snf complex, into SNF5-deficient malignant rhabdoid tumor cell line, causes destruction of actin stress fiber network and disappearance of extracellular focal adhesion [11]. Candida albicans is a polymorphic human opportunistic pathogen and the ability of transition among different forms is considered to correlate with its pathogenicity [12,13]. We have also characterized that a conserved Swi/Snf complex in this fungus was required for hyphal development and virulence by antagonizing the repression from Tup1 on hypha-specific gene expression and actin organization [14,15], and binding of Swi/Snf complex to promoters of hypha-specific genes is subsequent to nucleosome acetyltransferase of histone H4 (NuA4 complex), which is recruited by Efg1 the transcription factor of cAMP/PKA pathway in C. albicans [16]. In S. cerevisiae, evidences showed that Swi/Snf complex could remodel the chromosomal structure of FLO1 promoter by antagonizing Tup1/Ssn6 repressive complex [17]. Recently, components of Swi/Snf complex were isolated as the transcription activators of FLO11 in S. cerevisiae 133d strain, and disruption of these components caused defects in biofilm formation, invasive growth, and decreased FLO11 expression [18]. Moreover, Ste12/Tec1 could recruit Swi/Snf complex to STA1 promoter [19], which is almost identical to FLO11 promoter [20], suggesting similar regulatory mechanism of Swi/Snf complex in filamentous growth via FLO11.

Here we reported that the deletion of SWI1 in S. cerevisiae caused defect of filamentous growth, FLO11 expression, and proper cell separation. Moreover, overproducing S. cerevisiae Swi1 (ScSwi1) and C. albicans Swi1 (CaSwi1) in S. cerevisiae mediated different actions in invasive and pseudohyphal growth.

 

Materials and Methods

 

Strains and culture conditions

The S. cerevisiae strains used in this study are listed in Table 1. All strains are in P1278b genetic background. Yeast strains were routinely grown in 1% yeast extract, 2% peptone, 2% glucose (YPD) or synthetic complete (SC) medium at 30C. For filamentous growth, synthetic low-ammonia medium (SLAD) allowed for pseudohyphal growth and YPD medium used for invasive growth of S. cerevisiae, respectively, were prepared as described previously [21,22]. Appropriate yeast strains were streaked on SLAD plates, incubated for 1 week at 30C and then photographed. For invasive growth observation, strains were carefully patched on YPD plates and allowed to grow at 30C for 57 days. Cells that penetrated into agar were photographed after gentle wash with de-ionized water on agar surface [21,22].

 

Plasmid construction

All plasmids used in this work are listed in Table 2. Plasmid pNKY50-SWI1 containing S. cerevisiae URA3 flanked by 5' fragment and 3' fragment of SWI1 was constructed as following. The 0.9 kb of 5' fragment amplified with primers CTGAATTCATACTTCTCTTC TCCTCTC and GAAGATCTGCCTGTGCTATTGTTG TTA, and the 0.7 kb of 3' fragment amplified with primers GAGGATCCGATCGCAACAGTAACAAC and CATGCATGCTGGATTAGTGAATAACTGG from genomic DNA of wild-type strain L5528 were sequentially inserted into EcoRI/BglII and BamHI/SphI sites of plasmid pNKY50 [23], respectively.

 

Strain construction

Transformations of S. cerevisiae strains were performed as described previously [24]. The procedure for construction of S cerevisiae haploid swi1 and diploid swi1/swi1 mutants and genotypes of respective strains were described in Fig. 1. Briefly, URA+ his- swi1 strain SM1 was constructed from wild-type of a mating type strain L5528 transformed with EcoRI-linearized pNKY50-SWI1 and screened on SC-ura plate. The ura- his- swi1 strain SM2 was the derivate of SM1 after loop-out of one copy of URA3-HisG on 5-FOA plates. For construction of diploid mutants, EcoRI-linearized pNKY50-SWI1 was introduced into diploid wild strain L5783 to generate SWI1/swi1 heterozygote SM3, which was then induced for sporulation [25]. The spored swi1 mutant SM4 and SM5 were URA+ and screened out on SC-ura plate, and a or a mating types were identified by mating to the a type strain L5528 [25]. The his+ ura- a strain SM6 was from SM5 on 5-FOA plates, and mated with his- URA+ swi1 strain SM2 of a mating type to give rise to SWI1-distrupted homozygote SM7, which was the parental diploid strain of ura- swi1 null mutant SM8. Genotypes of all strains in construction were verified by Southern blot.

 

Southern blot and Northern blot

Genomic DNA isolation, Southern blot hybridization, total RNA extraction by hot phenol, Northern blot hybridization were demonstrated as previously described [26]. All probes were randomly labeled with Random Primers DNA Labeling System (Invitrogen) with [ a-[32]P]-dATP. The probe for Southern blot was 0.7 kb of SWI1 3' fragment, and in Northern blot FLO11 probe was amplified with primers ATGCCTAACTTCCAAA TTCAATTC and CTGGATGGAGTTGGTACTGGAGC, and ACT1 probe was amplified with primers GGTGAC GACGCTCCTCGTGC and TGAGGTAGAGAGAAA CCAG from genomic DNA of strain L5528.

 

Results

 

Knockout of ScSwi1

We constructed swi1 mutants in P1278b genetic background by homologous recombination. Most of SWI1 coding region including the fragment for ARID domain was substituted by a HisG-URA3-HisG insertion, whose loop-out with only one copy of HisG left could be screened out on a 5-FOA plate [Fig. 1(A)]. We successfully disrupted SWI1 in a mating-type haploid strain L5528 and knocked out one copy of SWI1 in diploid strain L5783. After sporulation, a mating-type haploid swi1 mutant strain could be readily obtained. The a ura- swi1 derivative was mated with a swi1 mutant strain generating diploid swi1/swi1 mutant strain [Fig. 1(B)]. The genotypes of all mutant strains were verified by Southern blot [Fig. 1(C)].

 

Haploid swi1 mutant is defective in invasive growth and FLO11 expression

In S. cerevisiae, haploid cells can invade into agar in search for nutrients upon glucose starvation, which correlates with some changes on cell-wall structure, such as abundant disposition of cell-wall protein Flo11, which is required for flocculation, cell adhesion, and filamentous growth in yeast [22]. After continuous incubation on YPD plates for 1 week, wild-type cells exhibited perfect invasive growth, whereas swi1 mutant cells lost its invading ability, which was consistent with highexpression level of FLO11 in wild-type cells but null in swi1 mutant. Re-introduction of SWI1 in high copy number vector in swi1 mutant could fully restore the invasive growth and gave higher FLO11 expression than wild-type (Fig. 2), suggesting that the Swi1 is essential for invasive growth and FLO11 expression in haploid cells.

 

Diploid swi1/swi1 mutant is defective in pseudohyphal growth and FLO11 expression

In diploid cells, nitrogen depletion can induce pseudohyphal growth on solid medium, where cells are elongated, attached, and budded in unipolar pattern [1]. On SLAD medium, diploid wild-type cells grew in typical pseudohyphae and formed branched filamentous colonies. In contrast, swi1/swi1 mutant cells were defective in pseudohyphal growth and displayed irregular smoothedged colonies [Fig. 3(A)]. Consistent to these phenotypes, FLO11 expression was prominent in wild-type cells but undetectable in swi1/swi1 mutant cells [Fig. 3(B)]. Overexpression of SWI1 in swi1/swi1 mutant could exhibited more flouring pseudohyphal growth and even higher FLO11 expression than wild-type (Fig. 3), indicating that the Swi1 is essential for pseudohyphal growth and FLO11 expression in diploid cells.

 

Deletion of SWI1 affects cell separation

In S. cerevisiae, haploid cells proliferate in axial pattern, and separate well after budding [27]. Although haploid swi1 mutant cells budded in axial pattern, but most cells attached together to form aggregates (averagely about 30 cells per aggregate) [Fig. 4(A)]. Diploid yeast cells adopt bipolar budding pattern [27], daughter cells bud at the opposite sites of previous budding scars, which could be obviously observed in diploid wild-type cells [Fig. 4(B)]. The bipolar budding pattern was not altered in diploid swi1/swi1 mutant cells, but the budded cells were attached and aggregated (averagely about 20 cells per aggregate) in pseudohyphae-like form [Fig. 4(B)]. Re-introduction of SWI1 restored the phenotypes of haploid swi1 and diploid swi1/swi1 mutants to wild-type (Fig. 4). These results suggest that Swi1 is required for proper cell separation in S. cerevisiae.

Caswi1 partially complemented haploid Scswi1 mutant, but not diploid mutant, in cell separation, invasive growth, and FLO11 expression

CaSwi1, which is required for the hyphal development in C. albicans, was recognized as the homologue of ScSwi1, since it could partially suppress the defect of glycerol utilization in haploid Scswi1 mutant in S288C background [14]. Consistent with the previous observations, in our P1278b background strains, overexpression of CaSWI1 could also partially complement haploid Scswi1 mutant in the defects of invasive growth, FLO11 expression, and cell separation (averagely about 10 cells per aggregate) [Figs. 2 and 4(A)]. However, unlike in haploid cells, cells carrying high copies of CaSWI1 still showed phenotypes identical to Scswi1/Scswi1 mutant including pseudohyphal growth, FLO11 expression, and cell separation (Figs. 3 and 4), suggesting CaSwi1 could not complement ScSwi1 in diploid cells and CaSwi1 could not simply replace it.

 

Swi1 promoting invasive growth requires Ste12 and Flo8

MAPK pathway downstream transcription factors Ste12 and cAMP/PKA pathway downstream transcription factor Flo8 are required for invasive growth and FLO11 expression in S. cerevisiae haploid cells [28]. We introduced a high copy ScSwi1 expression vector into haploid strains defective in components of MAPK or cAMP/PKA pathway, respectively. Overexpression of SWI1 could not promote invasive growth [Fig. 5(A)] and FLO11 expression [Fig. 5(C)] in ste7, ste12, tec1, or flo8 mutant. In wild-type cells, overproducing Swi1 could elevate FLO11 expression level. These results suggest that overexpressing Swi1 can not bypass the requirement of Ste7, Ste12, Tec1, and Flo8 in invasive growth and FLO11 expression in haploids. The Swi1 promotion depends on both MAPK and cAMP/PKA pathways.

 

Swi1 activating pseudohyphal growth requires Ste12 but not Flo8

To examine the effect of overexpressing SWI1 in pseudohyphal growth of diploid cells, we introduced the high copy SWI1 expression vector into diploid mutant strains, respectively. Overexpression of SWI1 could not activate pseudohyphal growth [Fig. 6(A)] and FLO11 expression [Fig. 6(B)] in mutants of MAPK pathway including ste12/ste12, tec1/tec1, ste7/ste7 and a double mutant ste12/12 phd1/phd1. In contrast, overproducing Swi1 partially suppressed the defect of flo8/flo8 cells in pseudohyphal growth and FLO11 expression (Fig. 6). Overexpression of SWI1 increased the FLO11 expression level and pseudohyphal growth in wild-type cells. These results suggest that the Swi1 activation in pseudohyphal growth and FLO11 expression depends on MAPK pathway but not cAMP/PKA pathway in diploid cells.

 

Ectopic expression of CaSwi1 promotes invasive and pseudohyphal growth in S. cerevisiae

To examine whether the CaSwi1 has an activation effect on invasive or pseudohyphal growth in S. cerevisiae, we introduced a high copy CaSWI1 expression vector into haploids and diploids. Overexpression of CaSwi1 promoted FLO11 expression in S. cerevisiae wild-type cells and exhibited a stronger FLO11 expression than strain overexpressing ScSwi1 [Figs. 5(C) and 6(B)]. Contrast to ScSwi1, overproducing CaSwi1 suppressed the invasive and pseudohyphal growth defects in all mutants examined [Figs. 5(B) and 6(A)]. Consistent with the phenotype, the FLO11 expression level was restored in CaSWI1-overexpression strain. In haploids, overproducing CaSwi1 resulted in the FLO11 expression increased by 7 folds in wild-type, 5 folds in flo8, 3 folds in tec1, 1 fold in ste12, respectively, compared with that in wildtype cells without carrying CaSWI1 [Fig. 5(C)]. In diploids, overproducing CaSwi1 also increased the FLO11 expression level by 13 folds in wild-type and mutant cells [Fig. 6(B)]. These results suggest that the CaSwi1 acts as an activator in promoting invasive or pseudohyphal growth via enhancement of the FLO11 expression and bypasses the requirement of MAPK or cAMP/PKA pathways.

 

Discussion

 

In this study, we have successfully deleted the ScSWI1 gene in P1278b background, including fragment coding for DNA-binding ARID domain. Previous study showed lethality after full deletion of SWI1 but viability via insertion mutation in 133d background [18]. However, the C-terminus of Swi1 (780 amino acids of total 1314 amino acids) has been demonstrated to fully complement the SWI1 deletion though in S288C background, indicating Swi1-C was sufficient for Swi1 functions [29]. Thus, our deletion of SWI1 (more than 1000 amino acids) was sufficient for functional analysis of Swi1. Loss of ScSwi1 decreased the stability of ScSwi3 in S. cerevisiae [30], and ScSwi3 served as the scaffold subunit of Swi/ Snf complex and was required for maintenance of the full structural integrity of this complex [31,32], suggesting that deleting ScSwi1 caused disassembly of the Swi/Snf complex. Our data showed that loss of ScSwi1 resulted in defect of invasive growth, pseudohyphal growth, proper cell separation, and FLO11 expression. We have previously demonstrated a C. albicans Swi/Snf complex is required for full cell separation, hyphal development and expression of hypha-specific genes [14], and invasion into agar [15]. The CaSWI1 can partially complement the growth defect of a Scswi1 mutant (non P1278b background strain) in the utilization of glycerol [14]. Although the CaSWI1 can also partially complement the defects of SM2 (Scswi1 mutant, P1278b background strain) in invasive growth and cell separation, but failed to complement pseudohyphal growth or cell separation in SM8 (Scswi1/Scswi1 mutant, P1278b background strain), suggesting that the CaSwi1 could not simply replace the ScSwi1 in Swi/Snf complex, and the integrity of native S. cerevisiae Swi/ Snf complex is essential for filamentous growth and for the activation by CaSwi1.

With loss of transcription factors of cAMP/PKA or MAPK pathway, such as Flo8, Ste12, or Tec1, mutants are prevented from expressing FLO11 and filamentous growth. Overexpression of ScSWI1 promoted filamentous growth and FLO11 expression in wild-type cells but not in some mutant cells. Overproducing ScSwi1 can suppress the defect of flo8 cells in pseudohyphal growth in diploids, but not invasive growth in haploids. Overexpression of SWI1 cannot bypass the requirement of Ste12 or Tec1 in invasive growth or pseudohyphal growth. Our data suggest that in haploid cells, both cAMP/PKA and MAPK pathways are required for invasive growth and FLO11 expression mediated by ScSwi1, presence of either pathway is insufficient for recruitment of the Swi/Snf complex to FLO11 promoter for further transcriptional activation. On the other hand, in diploid cells, only MAPK pathway but not cAMP/PKA pathway is required for Swi/Snf activation in pseudohyphal growth and FLO11 expression. The Swi/Snf complex may be recruited to FLO11 promoter by other transcription factors instead of the Flo8 during transcriptional activation.

In existence of endogenous ScSwi1, overexpressing CaSwi1 in S. cerevisiae not only promotes filamentous growth and FLO11 expression in wild-type but also in mutants with the deletion of MAPK or cAMP/PKA pathway components. Higher FLO11 expression level and stronger filaments formation are observed when the strain overexpressed with CaSWI1, suggesting that either MAPK or cAMP/PKA pathway is sufficient for activation of the CaSwi1, or alternatively, the CaSwi1 may be recruited by some other transcriptional factors to filamentous response elements of the FLO11 promoter mediate the activation of FLO11 expression and filamentous growth.

 

Acknowledgements

 

We thank Dr Stillman D.J. for providing S. cerevisiae plasmid BD1.

 

Funding

 

This work was supported by the grants from the National Science Foundation of China (30700006 and 30600008) and China Postdoctoral Science Foundation (20070421197).

 

References

 

1 Gancedo JM. Control of pseudohyphae formation in Saccharomyces cerevisiae. FEMS Microbiol Rev 2001, 25: 107123

2 Martens JA and Winston F. Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Curr Opin Genet Dev 2003, 13: 136142

3 Zhang Y, Smith CL, Saha A, Grill SW, Mihardja S, Smith SB and Cairns BR, et al. DNA translocation and loop formation mechanism of chromatin remodeling by SWI/SNF and RSC. Mol Cell 2006, 24: 559568

4 Tomar RS, Zheng S, Brunke-Reese D, Wolcott HN and Reese JC. Yeast Rap1 contributes to genomic integrity by activating DNA damage repair genes. EMBO J 2008, 27: 15751584

5 Schwabish MA and Struhl K. The Swi/Snf complex is important for histone eviction during transcriptional activation and RNA polymerase II elongation in vivo. Mol Cell Biol 2007, 27: 69876995. 6 Chai B, Huang J, Cairns BR and Laurent BC. Distinct roles for the RSC and Swi/Snf ATP-dependent chromatin remodelers in DNA double-strand break repair. Genes Dev 2005, 19: 16561661

7 Sudarsanam P, Iyer VR, Brown PO and Winston F. Whole-genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 2000, 97: 33643369

8 Shivaswamy S and Iyer VR. Stress-dependent dynamics of global chromatin remodeling in yeast: dual role for SWI/SNF in the heat shock stress response. Mol Cell Biol 2008, 28: 22212234. 9 Asp P, Wihlborg M, Karlen M and Farrants AK. Expression of BRG1, a human SWI/SNF component, affects the organisation of actin filaments through the RhoA signalling pathway. J Cell Sci 2002, 115: 27352746

10 Hill DA, Chiosea S, Jamaluddin S, Roy K, Fischer AH, Boyd DD and Nickerson JA, et al. Inducible changes in cell size and attachment area due to expression of a mutant SWI/SNF chromatin remodeling enzyme. J Cell Sci 2004, 117: 58475854

11 Medjkane S, Novikov E, Versteege I and Delattre O. The tumor suppressor hSNF5/INI1 modulates cell growth and actin cytoskeleton organization. Cancer Res 2004, 64: 34063413

12 Kumamoto CA. Niche-specific gene expression during C. albicans infection. Curr Opin Microbiol 2008, 11: 325330

13 Kumamoto CA. Molecular mechanisms of mechanosensing and their roles in fungal contact sensing. Nat Rev Microbiol 2008, 6: 667673

14 Mao X, Cao F, Nie X, Liu H and Chen J. The Swi/Snf chromatin remodeling complex is essential for hyphal development in Candida albicans. FEBS Lett 2006, 580: 26152622

15 Mao X, Li Y, Wang H, Cao F and Chen J. Antagonistic interplay of Swi1 and Tup1 on filamentous growth of Candida albicans. FEMS Microbiol Lett 2008, 285: 233241

16 Lu Y, Su C, Mao X, Raniga PP, Liu H and Chen J. Efg1-mediated recruitment of NuA4 to promoters is required for hypha-specific Swi/ Snf binding and activation in Candida albicans. Mol Biol Cell 2008, 19: 42604272

17 Fleming AB and Pennings S. Antagonistic remodelling by SwiSnf and Tup1Ssn6 of an extensive chromatin region forms the background for FLO1 gene regulation. EMBO J 2001, 20: 52195231

18 Barrales RR, Jimenez J and Ibeas JI. Identification of novel activation mechanisms for FLO11 regulation in Saccharomyces cerevisiae. Genetics 2008, 178: 145156

19 Kim TS, Kim HY, Yoon JH and Kang HS. Recruitment of the Swi/Snf complex by Ste12Tec1 promotes Flo8Mss11-mediated activation of STA1 expression. Mol Cell Biol 2004, 24: 95429556

20 Gagiano M, Van Dyk D, Bauer FF, Lambrechts MG and Pretorius IS. Divergent regulation of the evolutionarily closely related promoters of the Saccharomyces cerevisiae STA2 and MUC1 genes. J Bacteriol 1999, 181: 64976508

21 Gimeno CJ, Ljungdahl PO, Styles CA and Fink GR. Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 1992, 68: 10771090

22 Roberts RL and Fink GR. Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev 1994, 8: 29742985

23 Alani E, Cao L and Kleckner N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 1987, 116: 541545

24 Guthrie C, Abelson J, Simon M and Fink G. Guide to Yeast Genetics and Molecular Biology. Academic Press, 2004

25 Lundblad V. Current Protocols in Molecular Biology. John Wiley & Sons, Inc, 2003

26 Kohrer K and Domdey H. Preparation of high molecular weight RNA. Methods Enzymol 1991, 194: 398405

27 Casamayor A and Snyder M. Bud-site selection and cell polarity in budding yeast. Curr Opin Microbiol 2002, 5: 179186

28 Rupp S, Summers E, Lo HJ, Madhani H and Fink G. MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene. EMBO J 1999, 18: 12571269

29 Du Z, Park KW, Yu H, Fan Q and Li L. Newly identified prion linked to the chromatin-remodeling factor Swi1 in Saccharomyces cerevisiae. Nat Genet 2008, 40: 460465

30 Peterson CL and Herskowitz I. Characterization of the yeast SWI1, SWI2, and SWI3 genes, which encode a global activator of transcription. Cell 1992, 68: 573583

31 Stern M, Jensen R and Herskowitz I. Five SWI genes are required for expression of the HO gene in yeast. J Mol Biol 1984, 178: 853868

32 Yoon S, Qiu H, Swanson MJ and Hinnebusch AG. Recruitment of SWI/SNF by Gcn4p does not require Snf2p or Gcn5p but depends strongly on SWI/SNF integrity, SRB mediator, and SAGA. Mol Cell Biol 2003, 23: 88298845

33 Liu H, Styles CA and Fink GR. Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 1993, 262: 17411744

34 Madhani HD and Fink GR. Combinatorial control required for the specificity of yeast MAPK signaling. Science 1997, 275: 13141317

35 Liu H, Styles CA and Fink GR. Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 1996, 144: 967978

36 Lo HJ, Kohler JR, DiDomenico B, Loebenberg D, Cacciapuoti A and Fink GR. Nonfilamentous C. albicans mutants are avirulent. Cell 1997, 90: 939949

37 Wang H, Reynolds-Hager L and Stillman DJ. Genetic interactions between SIN3 mutations and the Saccharomyces cerevisiae transcriptional activators encoded by MCM1, STE12, and SWI1. Mol Gen Genet 1994, 245: 675685.