|
http://www.abbs.info e-mail:abbs@sibs.ac.cn ISSN 0582-9879
ACTA BIOCHIMICA et BIOPHYSICA SINICA 2003, 35(6): 503-510
CN 31-1300/Q |
A New Model of Trispecific Antibody Resulting the Cytotoxicity Directed against Tumor Cells
SONG Li-Ping, CHENG Ju-Long, WANG Xiang-Bin, ZHANG Zhong, FANG Min,
ZHOU Zhi-Yong, HUANG Hua-Liang*
( Institute of Genetics and Developmental Biology, the Chinese Academy of Sciences, Beijing 100101, China )
Abstract Bispecific antibodies (BsAb) with specificity to both tumor cells and CD3 molecule were believed to be promising immunological tools for the therapy with minimal residual diseases by activating cytotoxic T cells. However, without costimulatory molecule CD28, the activated T cells tended to apoptosis. In order to kill tumor cells more efficiently, a recombinant multifunctional single-chain trispecific antibody (scTsAb), which contains anti-ovarian carcinoma (OC) scFv, anti-CD3 scFv and VH domain of anti-CD28 antibody, was constructed and expressed in E. coli BL21 Star strain. The scTsAb showed strong binding avidities to membrane antigen of SK-OV-3 cell, CD3 molecule on Jurkat cell, and recombinant CD28 antigen. It was further demonstrated that this scTsAb could activate peripheral blood T cells to elicit strong cytotoxicity against SK-OV-3 cells. This new type of recombinant scFv antibody set up a new technological platform for T cells based immunotherapy against cancer, especially with the failure on MHC antigen presentation or absence of costimulating signal.
Key words trispecific antibody (TsAb); scFv; ovarian carcinoma (OC); CD3; CD28
According to the immune surveillance hypothesis, tumor antigens could be the targets for tumor immune destruction. However, down regulation of anti-tumor immune response in tumor patients often leads to tumor immune escape[1]. Considerable efforts had been made to induce efficient immune reaction. One promising strategy was bispecific antibodies (BsAb) based approaches to retarget effective cells to mediate cytotoxicity against tumor cells[2,3].
Two strategies had been introduced so far: firstly, FcγR-bearing effective cells such as macrophages and NK cells were recruited toward tumor cells using anti-FcγR × anti-TAA (tumor associated antigen) antibodies[4], secondly, anti-CD3 × anti-TAA antibodies attracted effective T cells to kill tumor cells in coordination with costimulating signals[5]. The latter strategy was more promising because it aimed at the activation of T lymphocytes that were highly specific effector in mediating cytotoxicity. However, according to the 2-signal model of T cell activation, the effective activation of T cells demanded a “second” costimulatory signal in addition to triggering TCR-CD3 complex. Anti-CD3 antibody signals via CD3 simulated physiological antigen-TCR/CD3 complex by MHC concomitant antigen. Costimulatory signals, such as CD28/B7, CD154/CD40, CD2/CD58, and LFA-1/ICAM-1[6], ensured the optimal T cell activation. The best-characterized second signal molecule was CD28. Anti-CD28 antibody resembled CD28 ligands B7-1 and B7-2, which could interact with CD28 to promote T-cell survival and initiate T-cell clonal expansion and differentiation[7]. By now, almost all the tumor immunotherapy with CD28 costimulation employed two forms, either anti-TAA×anti-CD3 bispecific antibody in combination with anti-TAA×anti-CD28 bispecific antibody[8,9], or anti-TAA×anti-CD3 bispecific antibody and anti-CD28 antibody conjugate[10].
The development of BsAb had undergone chemical conjugation period, somatic fusion period and genetic engineering period[11]. Trispecific antibody (TsAb) had almost undergone the same route. Using the sulfhydryl-specific cross-linker o-phenylenedi-maleimide (o-PDM), a chemical conjugated TsAb [F(ab')3] had been developed[12,13]. However, the high cost, low efficiency, laborious work and by-products in producing clinical TsAbs hindered their development. Genetic engineering approaches offered a new potential means. Recombinant disulfide stabilized Fab-(scFv)2 TsAbs were built by C-terminal fusion of scFv molecules to both of the VL-CL (L) and VH-CH1 (Fd) chains in Fab chains, which could be expressed in mammalian cells[14,15].

(A) Intermediate plasmid for construction pTRI. pUHM1, pALM-Fc/BsAb, pTMF-CD28 pUHM2, pTRI. (B) Structure of psTRI.In the present study, a recombinant scFv-based TsAb was constructed which combined activating and costimulating functions within the single chain molecule. In the scTsAb, anti-OC antigen scFv, anti-CD3 ε chain scFv and VH domain of anti-CD28 antibody were linked by two specifically designed interlinkers. The two interlinkers were HSA and Fc fragments which were supposed to prolong the half-life of scTsAb in vivo and perhaps append its complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC) functions. The scTsAb could promote the formation of conjugate of the ovarian carcinoma cell and CD3/TCR complex, juxtaposing CD28 molecule on the surface of T cell. Cytolytic T cells that could lyse tumor cells in MTT assay were generated when peripheral blood leukocytes were activated in the presence of tumor cells and scTsAb. These results demonstrated that scTsAb could delivery signal 1 and signal 2 in T cells and efficiently boost tumor lysis activity of T cells. It put forward a new way for powerful CD3-based immunotherapy without simultaneous administration of other costimulatory molecules.
1.1 Antibodies
and cell lines
Anti-CD3 monoclonal antibody was purchased from Wuhan Institute of Biological Products (Wuhan, China). RhCD28/Fc Chimera, recombinant human CD28 extracellular domain fused to human IgG1 Fc were products of R&D System Inc. (USA). Protein prestained markers were purchased from NEB Biolabs. SK-OV-3 and Jurkat cell lines (human leukemia T cell lymphoblast) were kept by our laboratory. Anti-OC scFv, anti-OC × anti-CD3 bispecific antibodies were prepared by renaturing and purifying the inclusion body expressed in E. coli[16].
1.2 Construction
of trispecific antibody
The backbone of scTsAb was obtained via splicing by overlapping extention (SOE)-PCR method with six oligonucletides P1, P2, P3, RE1, RE2, RE3 (Table 1). The backbone of scTsAb was cloned into HindIII and EcoRI sites of pUC19 to yield pUHM1 [Fig.1(A)]. The anti-OC scFv × anti-CD3 scFv bispecific antibody coding fragment, cloned from plasmid pALM-Fc/BsAb[16] with XhoI and BamHI double digestion, was inserted to pUHM1 to get pUHM2. Finally the fragment containing BsAb and backbone of the scTsAb was shifted from pUHM2 to pTMF-CD28 (containing VH domain of anti-CD28 antibody)[17] by NdeI and HindIII digestion, Finally the expression vector of trispecific single chain antibody was constructed, designated as pTRI [Fig.1(A)]. In order to increase the solubility of TRI, the trispecific fragment was cloned to plasmid pTRFA[18] by using primer 'TRI up' and 'TRI down' (Table 1) (LA Taq DNA polymerase). The orientation was confirmed by sequencing and this plasmid was named as psTRI [Fig.1(B)].
|
Name |
Sequence |
|
P1 |
5'-CCCAAGCTTATGAAATACCTATTGCCTACGGC-3' |
|
P2 |
5'-GCCCAGGTGAAACTGCCGTGCCGTCCATGTACTCACACCACTGACGGTCTGCCGACCAAATTGGAAGGTGGTGGTGGTTC-3' |
|
P3 |
5'-CTGCTGGTTCGTTACACCAAGAAAGTACCCCAAGTGTCAACTCCAACTCCTGTAGAGGTCTCAGGTGGTGGTGGTTCTCAT-3' |
|
RE1 |
5'-CCGGAATTCCATATGAGAACCACCACCACC-3' |
|
RE2 |
5'-TTCTTGGTGTAACGAACCAGCAGCGCATTCTGGAAAGAACCACCACCACCGGATCC CTCGAGAGAACCACCACCACCTTCC-3' |
|
RE3 |
5'-GGCACGGCAGTTTCACCTGGGCCATGGCTGGTTGGGCAGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAGGTATT-3' |
|
TRI up |
5'-CATCACCATCACCATCACCCGTGCCGTCCATGTACTCAC-3’ |
|
TRI down |
5'-TTACGGGCAAGGTGGACAAGT-3’ |
1.3 Confirmation of the expression of trispecific antibody
E. coli BL21 Star (DE3) (Invitrogen Co., USA) was transformed with pTRI or psTRI, the cells were cultured to A600≈0.4 at 37 ℃ in 1 L LB media containing 50 mg/L kanamycin. The culture was then induced at 30 ℃ for 4 h with 0.4 mmol/L isopropyl-β-D-thiogalactopyranoside(IPTG). The cells were then harvested by centrifugation at 4000 r/min for 10 min at 4 ℃.The pellets were resuspended in 100 mL phosphate-buffered saline (PBS), and then lysed by sonication, and then centrifuged at 10 000 r/min for 30 min to get the supernatant. The proteins were fractionated by 10% SDS-PAGE and then blotted to nitrocellulose membrane. Because the scTsAb recombinant proteins, TRI and sTRI for pTRI and psTRI respectively, contains the c-myc tag for detection, Western blotting was performed using mouse anti-c-myc antibody (9E10) (SantaCruz, USA) and horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (Jackson, USA) as described[19].
1.4 Functional
characterization of trispecific antibody
1.4.1 The antigen binding assay The antigen binding activities of sTRI to Jurkat cell membrane antigen, SK-OV-3 cell membrane antigen, and rhCD28/Fc antigen were studied by enzyme-linked immunosorbant assay (ELISA) as described before[19]. Briefly, ELISA was performed with the antigen immobilized on 96-well plates. The sTRI protein bound with antigen was detected by mouse anti-c-myc tag 9E10 antibody, followed by HRP-conjugated goat anti-mouse antibody, incubation with peroxidase substrate, and finally measurement of absorbance at 490 nm. The supernatant of expression product of empty vector was set as negative control.
1.4.2 Bridge FACS (fluorescence activated cell sorting) assay Bridge FACS analysis was performed as described[20]. Briefly, Jurkat cells was preactivated with 80 ku/L IL-2 (Institute of Hematology & Hospital of Blood Diseases, China), 50 μg/L CD3 monoclonal antibody for three days, and then washed with RPMI-1640 for two times. Jurkat cells were resuspended in RPMI-1640 (pH 6.8) and mixed with FITC(fluorescein isothiocyanate, Sigma) at a final concentration of 0.5 mg/L. SK-OV-3 were resuspended in RPMI-1640 (pH 7.2) and mixed with TRITC at a final concentration of 1.5 mg/L. Both these two kinds of cells were incubated for 30 min at 37 ℃, 5% CO2, washed twice, and then resuspended in RPMI-1640 (pH 7.2) independently. The concentration of activated Jurkat cells and SK-OV-3 cells were adjusted to 2×109 and 4×108 cells/L, respectively. To demonstrate cross-linking, equal volumes of FITC labeled activated Junkat cells and TRITC labeled SK-OV-3 cells[21] were mixed at a ratio of 5:1. sTRI lyses supernatant (60 mg/L total protein) were added to the cells, mixed, and incubated at 37 ℃ for 30 min, and then subjected to FACS analysis. Analysis were per-formed using CellQuest software (Becton, Dickinsin).
1.4.3 In vitro cytotoxicity assay Human peripheral blood leukocyte cells (PBL) of healthy donors were isolated from peripheral blood by method of Ficoll density gradient centrifugation, monocyte/macrophage fraction was depleted by glass adherence method for 2 h at 37 ℃, 5% CO2. SK-OV-3 target cells were plated in 96-well flat-bottom plate and incubated with different dilutions of supernatant containing sTRI overnight to prepare cell monolayer bound with antibody. Freshly isolated effector cells (PBL) were added to the monolayer of tumor cells at appropriate ratios. Plates were incubated at 37 ℃ for 72 h. Other procedures were carried out as described[22].
1.4.4 Morphologic analysis 2×102 SK-OV-3 target cells were incubated in 6-well flat-bottom plate overnight. Effector cells (PBLs) were pretreated with sTRI overnight, washed two times, and then added into the SK-OV-3 plate with E/T ratio of 20:1. The cells were co-incubated with appropriate sTRI supernatant for 2 h, 4 h and 10 h, respectively. The morphology of the cells was investigated.
2.1 Construction
of trispecific antibody scTsAb
To express scTsAb that was composed of partial anti-CD28 (AF336117), anti-CD3 and anti-OC antibodies, its expression vectors pTRI and psTRI were constructed as shown in Fig.1(A,B). The universally acknowledged flexible glycine-rich sequence (G4S)3 was inserted between each VH and VL to restrict intra-chain pairing. In order to provide sufficient flexibility to allow each molecule to bind their respective receptor simultaneously, interlinker-Fc (NSTYRVVSVLTVLHQDWLNGKEYKCK) and interlinker-HSA (FQNALLVRYTKKVPQVSTPTPVE-VS) were also introduced. c-myc tag was added for immunodetection. In psTRI [Fig.1(B)], the scTsAb was co-expressed with FkpA under the control of the same T7 promoter and lac operator. To avoid wrong assembling of each antibody in sTRI, the orientation of sTRI was specifically designed as (anti-OCVH)-(anti-OCVL)-interlinker- (anti-CD3VL)-(anti-CD3VH)-interlinker-anti-CD28VH) [Fig.1(B)].
2.2 Confirmation
of the expression of trispecifc antibody

Fig.2 SDS-PAGE
(left) and Western blotting (right) of pTRI and psTRI
The molecular weight was marked at right. The arrows indicated the band of desired TRI and psTRI (about 84 kD). The loading order in SDS-PAGE and Western blotting is: 1 and 2, supernatant (S) and pellet (P) of E. coli cells harboring pTMF; 3 and 4, supernatant and pellet of E. coli cells harboring pTRI; 5, molecular weight marker (in Western, prestained marker); 6 and 7, supernatant and pellet of E.coli cells harboring psTRI; 8 and 9, supernatant and pellet of E. coli cells harboring pTRFA vector.

(A) sTRI-anti-CD28 ELISA assay. 100 μL of CD28 (1 mg/L) antigen (rhCD28/FcChimera) was coated on ELISA plate overnight, incubated with different dilution of supernatant of sTRI and control, respectively. sTRI CD28 stands for lysed supernatant of induced E. coli cells harboring psTRI; Control CD28, stands for supernatant of induced E. coli cells harboring plasmid pTRFA. (B) sTRI-anti-CD3 and sTRI-anti-SK-OV-3 ELISA assay. Jurkat and SK-OV-3 cell membrane antigens were prepared by sonication for 80 s and then centrifugated for 10 min at 12 000 r/min. 100 μL of Jurkat and SK-OV-3 membrane antigen (100 mg/L) were coated on ELISA plate overnight at 4 °C. Control SKOV, SK-OV-3 cell membrane antigen was coated and the expression product of pTRFA was used as the first antibody; sTRI SKOV, SK-OV-3 cell member antigen was coated and the expression product of psTRI was used as the first antibody; Control Jurk, Jurkat cell membrane antigen was coated and the expression product of pTRFA was used as the first antibody; sTRI Jurk, Jurkat cell membrane antigen was coated and the expression product of psTRI was used as the first antibody. The original lysed supernatant concentration was 250 mg/L.The expression result was detected by SDS-PAGE and Western blotting (Fig.2). scTsAb could be observed with the expected molecular weight of 84 kD. TRI protein accounted for about 4% of the total bacteria protein and 37.67% was in supernatant. In order to obtain large amounts of soluble scTsAb, FkpA-based co-expression vector psTRI was constructed. The expression profiles and Western blotting results suggested the chaperone molecule FkpA could improve the solubility of the scTsAb greatly (Fig.2). The sTRI protein accounted for about 9.81% of the total bacteria protein and the soluble part of sTRI reached its 62.63%. Due to its high solubility, sTRI was used in further experiments.
2.3 Functional
characterization of trispecific antibody
2.3.1 Binding properties of sTRI To confirm the antigen binding properties of each component in scTsAb, ELISA was performed as mentioned in materials and method. The results demonstrated that sTRI had relatively high binding affinities with Jurkat membrane CD3 antigen, CD28 antigen, and SK-OV-3 membrane antigen, respectively, while the binding activities of control were relatively low (Fig.3). The results implied the other ingredients in the supernatant had little effect on the binding of sTRI to antigens. Besides, the antibody dilution ratio among 1∶5 to 1∶80 (about 50-1.25 mg/L) was optimal in ELISA assays and the cytotoxicity assay described below got the similar results.
FACS analysis demonstrated that sTRI could physically cross-link Jurkat cells and ovarian carcinoma SK-OV-3 cells (Fig.4). CD3+ and CD28+ Jurkat cells were prelabled with FITC, and SK-OV-3 cells with TRITC, respectively. In a representative experiment, only in the presence of sTRI, double-positive colored cell population increased greatly in the FACS analysis [top right quadrant in Fig.4(A) right], which implied that scTsAb could mediate Jurkat cells' binding with tumor cells, whereas in the control experiment with antibody free or vector, the expression supernatant could not. The percentage of SK-OV-3 that bound to Jurkat cells in the presence of sTRI was calculated with CellQuest software to be 92.14%

Fig.4 Bridge FACS analysis
Bridge FACS analysis of FITC-labled Jurkat cells and TRITC-labled SK-OV-3 cells in the presence of sTRI lysed supernatant (12 mg/L). (A) The cells in the upright quadrant represented the cross-linking of the two different types of cells. (B) SK-OV-3 cells that acquired FITC fluorescence were a result of binding to T cells. The marker region (M1) stands for SK-OV-3 cells that linked with FITC labeled T cells. FL1 represented FITC; FL2, represented TRITC; Auto, the supernatant of vector expression production was set as negative control.
compared with 41.43%, 49.82% when antibody free and vector supernatant were used [Fig.4(B)].
2.3.2 The cytotoxcity assay of sTRI To further examine the utility of this new trispecific antibody for application in tumor therapy, MTT based cytotoxicity assay was performed to evaluate the ability of effector T cells to destroy SK-OV-3 tumor cells in the presence of scTsAb. Different from the BsAb MTT cytotoxicity assay, the PBLs used in cytotoxicity assay had not been pre-treated with low dose of IL-2 or anti-CD3 monoclonal antibody. The cytotoxicity results [Fig.5(A)] showed that the scTsAb has an effective cytotoxicity to tumor cells. sTRI functioned best at the concentration of about 12 mg/L total bacterial protein and with the increase of dilution ratio, the killing ratio decreased gradually. So this concentration was used in further experiments. To confirm the cytotoxicity against tumor cells effectively, a series of controls have been set: BSCD28 [anti-OC × anti-CD3 bispecific antibody (2.1 mg/L)[16] + anti-CD28 antibody (40 μg/L)], BS [anti-OC-CD3 bispecific antibody (2.1 mg/L)], CD3 (2.8 mg/L) [Fig.5(B)]. The induced lysate supernatant of E. coli cells carrying pTRFA (about 12 mg/L total bacterial protein) was used as negative control. The supernatant of sTRI (12 mg/L total bacterial protein) had almost the same cytotoxicity behavior as positive control BSCD28, which is higher than BsAb and CD3 as expected. In Fig.5(C), the supernatant of sTRI (60 mg/L total bacterial protein) lysed the tumor cell more efficiently than OCCD3CD28 [anti-OC scFv (4 mg/L), anti-CD3 monoclonal antibody (20 μg/L) + anti-CD28 monoclonal antibody (40 μg/L)], OCCD3 [anti-OC scFv (4 mg/L), anti-CD3 monoclonal antibody (2.8 mg/L)]. The results showed the scTsAb has strong ability to redirect T cells to kill tumor cells. Cytotoxicity experiment revealed a correlationship between an increase in binding ability for SK-OV-3 and the ability of the scTsAb to argument lysis of SK-OV-3 cells [Fig.3(B), Fig.5(A)]. With the decrease of the binding ability to ovarian carcinoma, the cytotoxicity mediated by scTsAb decreased. This finding suggested that with higher affinity to tumor cells, the scTsAb had more time to adhere to tumor cells and created more chances for the T cells to bind and kill tumor cells.
Most of the tumor cells were destroyed within 24 h after exposure to effective cells in the presence of scTsAb. At E/T ratio of 25∶1, after coincubation with

Fig.5 sTRI-mediated cytotoxicity in vitro
(A) Different concentration of sTRI-mediated cell death of SK-OV-3 cells by activated human PBL as determined by MTT assay. Original, 12 mg/L total bacterial protein; Dilution10, 120 mg/L total bacterial protein; Dilution100, 1.2 mg/L total bacterial protein; Dilution1000, 0.12 mg/L total bacterial protein. (B) and (C), sTRI-mediated cytotoxicity with different control. sTRI, stands for anti-CD3×anti-CD28×anti-OC trispecific antibody; Vector control, the lysed supernatant of E. coli cells carrying plasmid pTRFA;BSCD28, anti-OC × anti-CD3 bispecific antibody + anti-CD28 antibody; BS, anti-OC×anti-CD3 bispecific antibody; CD3, anti-CD3 antibody; OCCD3CD28, anti-OC scFv + anti-CD3 + anti-CD28 monoclonal antibody; OCCD3, anti-OC scFv + anti-CD3 monoclonal antibody. (D) Morphology change of SK-OV-3 and Jurkat cells after treated with sTRI for 2 h, 4 h, and 10 h (40×). The lateral arrows indicated the PBLs, the vertical arrows indicated the SK-OV-3 cells. sTRI for 2 h, SK-OV-3 cells were adhered with effector T cells forming the wreath; when coincubated for 4 h, T cells started to lyse SK-OV-3 cells, the profile of SK-OV-3 was blurred; after 10 h coincubation, most of the tumor cells collapsed [Fig.5(D)]. Finally, the SK-OV-3 cells vanished in the medium, leaving the PBLs alone.
T-cell based anti-tumor immunotherapy requires full and efficient T-cell activation[23]. It is generally accepted that T-cell activation requires two distinct signals. Signal through the T-cell receptor alone can lead to anergy or activation-induced cell death (AICD)[24]. Costimulation with CD28 decreases the probability of lymphocytes apoptosis and prolongs the lifespan of lymphocytes in vitro[25]. Ligation of CD28 by agonistic antibody has been shown to prevent AICD of native T cells during primary stimulation[26].
We describe the antitumor properties of a new class of trispecific antibody. To our knowledge, it is the first report that a single-chain trispecific antibody can activate the two signals on T cells simultaneously. An anti-OC, anti-CD3 ε chain and anti-CD28 composed scTsAb was constructed with the intent of recruiting T cells to the ovarian tumor cells, where they were activated to destroy the ovarian carcinoma cells [Fig.5(D)]. The ELISA result and FACS bridge analysis showed the scTsAb could recognize and bind specifically with ovarian carcinoma member antigen, CD3 complex and CD28 molecule on T-lymphocytes. In this construction, anti-CD3 ε chain scFv acts with TCR-CD3 complex, mimics the stimulation of T cells as an antigen (signal 1), VH domain of anti-CD28 antibody simulates the B7 molecule expressed on antigen processing cell (APC), interact with CD28 on T cells (signal 2). The scTsAb set up a bridge between ovarian carcinoma cells and T cells and created a microenvironment for the T cell activation and T cell killing effect (Fig.6). The cytotoxicity mediated by sTRI revealed that the scTsAb functions as scBsAb plus CD28 monoclonal antibody [Fig.5(B)] and was better than anti-OC scFv plus anti-CD3, anti-CD28 monoclonal antibody [Fig.5(C)].
To ensure properly and functionally refolding of each antibody within scTsAb, partial sequences of HSA and Fc were introduced as interlinkers. ELISA and FACS analysis demonstrated that each antibody within scTsAb refolded correctly. Poznansky et al.[27] have demonstrated that the stability of HSA conjugated protein in animal body increased 20-40 times. In the animal test of recombinant single chain BsAb in our lab, the half-life of the BsAb containing HSA linker elonged to three times compared with the BsAb without the HSA (unpublished data). To enhance the solubility of the scTsAb expression in E. coli, FkpA, a heat shock periplasmic peptidyl-prolyl cis/trans isomerase (PPIase) was introduced, which could suppress the formation of inclusion bodies[28,29]. The results proved that it could facilitate the soluble expression of scTsAb greatly when it was co-expressed with target protein (Fig.2).

(A) In the native condition, with the costimulation of CD28, the TCR expressed on CTL cell recognized the antigen peptide-MHC on tumor cell and elicited a signal cascade to active T cell to attack tumor cell. However this pathway might be disrupted by the deficiency of tumor antigen expression, MHC I molecule, B7 co-stimulatory signal and antigen presentation ability of patients. (B) In the modified model, TRI contained anti-tumor arm to bind to tumor cells, CD3 and CD28 arms to 'pull' and active T cells to attack tumor cells. At the same time, the HSA fragment on TRI molecule could prolong the half-life-time of sTRI in sera and the Fc fragment on the TCR might trigger the FcγR+ cell to kill tumor cells too.
In summary, the multifunctional scTsAb has many advantages. (1) It can bind to cytotoxicity T cells and tumor cells simultaneously and then active T cell to kill tumor cells in a highly tumor specific manner. (2) It can initiate and sustain high level of cytotoxicity reactivity through CD3 and CD28 “two signal” triggering. (3) It has optimal intermediate molecule size (about 84 kD) which is small enough to penetrate tumors and large enough to sustain in circulation for an appropriate period of time. (4) It is genetically engineered to minimize the human anti-antibody (mouse Ig) (HAMA) reaction which has hindered the clinical application of many mouse monoclonal antibody[30] and easy of manufacturing. It would set up a new approach on the way to successful elimination of disseminated tumor cells.
1 GilBoa E. How tumors escape immune destruction and what we can do about it. Cancer Immunol Immunother, 1999, 48(7): 382-385
2 Zhu Z, Lewis GD, Carter P. Engineering high affinity humanized anti-p185HER2/anti-CD3 bispecific F(ab') 2 for efficient lysis of p185HER2 overexpressing tumor cells. Int J Cancer, 1995, 62(3): 319-324
3 Kroesen BJ, ter Haar A, Spakman H, Willemse P, Sleijfer DT, de Vries EG, Mulder NH et al. Local antitumor treatment in carcinoma patients with bispecific-monoclonal-antibody-redirected T cells. Cancer Immunol Immunother, 1993, 37(6): 400-407
4 Valerius T, Stockmeyer B, van Spriel AB, Graziano RF, van den Herik-Oudijk I, Repp R, Deo YM et al. FcalphaRI (CD89) as a novel trigger molecule for bispecific antibody therapy. Blood, 1997, 90(11): 4485-4492
5 Segal DM, Weiner GJ, Weiner LM. Introduction: Bispecific antibodies. J Immunol Methods, 2001, 248(1-2): 1-6
6 Salomon B, Bluestone JA. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu Rev Immunol, 2001, 19: 225-252
7 Sharpe AH, Freeman GJ. The B7-CD28 superfamily. Nat Rev Immunol, 2002, 2(2): 116-126
8 Holliger P, Manzke O, Span M, Hawkins R, Fleischmann B, liu QH, Wolf J et al. Carcinoembryonic antigen (CEA)-specific T-cell activation in colon carcinoma induced by anti-CD3 × anti-CEA bispecific diabodies and B7 × anti-CEA bispecific fusion proteins. Cancer Res, 1999, 59(12): 2909-2916
9 Grosse-Hovest L, Brandl M, Dohlsten M, Kalland T, Wilmanns W, Jung G. Tumor-growth inhibition with bispecific antibody fragments in a syngeneic mouse melanoma model: The role of targeted T-cell co-stimulation via CD28. Int J Cancer, 1999, 80(1): 138-144
10 Daniel PT, Kroidl A, Kopp J, Sturm I, Moldenhauer G, Dorken B, Pezzutto A. Immunotherapy of B-cell lymphoma with CD3x19 bispecific antibodies: Costimulation via CD28 prevents “veto” apoptosis of antibody-targeted cytotoxic T cells. Blood, 1998, 92(12): 4750-4757
11 Kriangkum J, Xu B, Nagata LP, Fulton RE, Suresh MR. Bispecific and bifunctional single chain recombinant antibodies. Biomol Eng, 2001, 18: 31-40
12 Tutt A, Stevenson GT, Glennie MJ. Trispecific F(ab') 3 derivatives that use cooperative signaling via the TCR/CD3 complex and CD2 to activate and redirect resting cytotoxic T cells. J Immunol, 1991, 147(1): 60-69
13 Wong WM, Vakis SA, Ayre KR, Ellwood CN, Howell WM, Tutt AL, Cawley MI et al. Rheumatoid arthritis T cells produce Th1 cytokines in response to stimulation with a novel trispecific antibody directed against CD2, CD3, and CD28. Scand J Rheumatol, 2000, 29(5): 282-287
14 Schoonjans R, Willems A, Schoonooghe S, Leoen J, Grooten J, Mertens N. A new model for intermediate molecular weight recombinant bispecific and trispecific antibodies by efficient heterodimerization of single chain variable domains through fusion to a Fab-chain. Biomol Eng, 2001, 17(6): 193-202
15 Schoonjans R, Willems A, Schoonooghe S, Fiers W, Grooten J, Mertens N. Fab chains as an efficient heterodimerization scaffold for the production of recombinant bispecific and trispecific antibody derivatives. J Immunol, 2000, 165(12): 7050-7057
16 Fang M, Zhao R, Li H, Jiang X, Yin CC, Lin Q, Huang HL. Construction and expression of an anti-human ovarian carcinoma × anti-human CD3 bispecific single-chain antibody and its refolding studies. High Technology Letters, 2002, 12(143): 47-50
17 Cheng JL, Wang XB, Zhang Z, Liu J, Yao XS, Huang HL. A method for construction reshaping single-domain antibody. Acta Genetics Sinica, 2002, 29(3): 189-195
18 Zhang Z, Song LP, Fang M, Wang F, He D, Zhao R, Huang HL et al. Overexpression of bacterial peptidyl-prolylisomerase fkpA markedly improves soluble and functional production of engineering antibodies in Escherichia coli. Biotechniques, 2003, Submited
19 Zhang Z, Li ZH, Wang F, Fang M, Yin CC, Zhou ZY, Lin Q et al. Overexpression of DsbC and DsbG markedly improves soluble and functional expression of single-chain Fv antibodies in Escherichia coli. Protein Expr Purif, 2002, 26: 218-228
20 Kriangkum J, Xu B, Gervais C, Paquette D, Jacobs FA, Martin L, Suresh MR. Development and characterization of a bispecific single-chain antibody directed against T cells and ovarian carcinoma. Hybridoma, 2000, 19(1): 33-41
21 Kreutz FT, Xu DZ, Suresh MR. A new method to generate quadromas by electrofusion and FACS sorting. Hybridoma, 1998, 17: 267-273
22 Heo DS, Park JG, Hata K, Day R, Herberman RB, Whiteside TL. Evaluation of tetrazolium-based semiautomatic colorimetric assay for measurement of human antitumor cytotoxicity. Cancer Res, 1990, 50(12): 3681-3690
23 Chambers CA. The expanding world of co-stimulation: The two-signal model revisited. Trends Immunol, 2001, 22(4): 217-223
24 Daniel PT, Kroidl A, Cayeux S, Bargou R, Blankenstein T, Dorken B. Costimulatory signals through B7.1/CD28 prevent T cell apoptosis during target cell lysis. J Immunol, 1997, 159(8): 3808-3815
25 Levine BL, Bernstein WB, Connors M, Craighead N, Lindsten T, Thompson CB, June CH. Effects of CD28 costimulation on long-term proliferation of CD4+ T cells in the absence of exogenous feeder cells. J Immunol, 1997, 159(12): 5921-5930
26 Boise LH, Minn AJ, Noel PJ, June CH, Accavitti MA, Lindsten T, Thompson CB. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-XL. Immunity, 1995, 3(1): 87-98
27 Poznansky MJ, Halford J, Taylor D. Growth hormone-albumin conjugates. Reduced renal toxicity and altered plasma clearance. FEBS. Lett, 1988, 239(1): 18-22
28 Arie JP, Sassoon N, Betton JM. Chaperone function of FkpA, a heat shock prolyl isomerase, in the periplasm of Escherichia coli. Mol Microbiol, 2001, 39(1): 199-210
29 Bothmann H, Pluckthun A. The periplasmic Escherichia coli peptidylprolyl cis, trans-isomerase FkpA. I. Increased functional expression of antibody fragments with and without cis-prolines. J Biol Chem, 2000, 275(22): 17100-17105
30 Yang G, Ran YL, Sun LX, Liu J, Yu L, Yang ZH. High expression in CHO cells and activity of an anti-P185erbB2 mouse/human chimeric antibody. Acta Biochim Biophys Sin, 2001, 33(1): 87-92
Received: February 17, 2003Accepted: March 24, 2003
This work was supported by a grant from the National High Technology Research and Development Program of China (863 Program) (No. 863-102-09-04-01)
*Corresponding author: Tel, 86-10-64857285; Fax, 86-10-64857285; e-mail, HLhuang@genetics.ac.cn