http://www.abbs.info e-mail:abbs@sibs.ac.cn

ISSN 0582-9879                             ACTA BIOCHIMICA et BIOPHYSICA SINICA 2003, 35(6): 573-579                             CN 31-1300/Q

 

Short Communication

Improving the Specific Synthetic Activity of a Penicillin G Acylase Using DNA Family Shuffling

ZHOU Zheng, ZHANG Ai-Hui, WANG Jing-Ru1, CHEN Mao-Lin1, LI Ren-Bao, YANG Sheng1*, YUAN Zhong-Yi*

( Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, the Chinese Academy of Sciences, Shanghai 200031, China; 1 Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, the Chinese Academy of Sciences, Shanghai 200032, China )

 

Abstract        Penicillin G Acylas (PGA) of Providencia rettgeri (ATCC 25599) was evolved using a modified DNA family shuffling method. The identity of pga genes from Escherichia coli, Kluyvera citrophila and Providencia rettgeri ranges from 62.5% to 96.9%. The pga genes from above three species were recombined and shuffled to create interspecies pga gene fusion libraries. By substituting assembled chimaeras for corresponding region of pETPPGA, different recombinants were constructed and expressed in E. coli JM109(DE3). Mutants with obvious β-lactam synthetic activity were selected from the plates and the ratios of synthesis to hydrolysis (S/H) were determined subsequently. It was shown that the primary structures of selected positives exhibited significant diversity among each library. The best mutant possessed 40% higher synthetic activity than the wild type enzyme of PrPGA. It was further proved in this study that the domain of α subunit contributed much more to improve the specific activity of synthesis. Results showed a recombinant PGA with higher synthetic activity was acquired by the method of DNA shuffling.

 

Key words     penicillin G acylase; DNA family shuffling; S/H ratio

 

Penicillin G acylase (PGA EC 3.5.1.11) is an important hydrolase which catalyzes the deacylation and acylation reactions, and can be commercially used as a transferase to catalyze the synthesis of condensation products such as β-lactam antibiotics[1]. Because of the high value, PGAs had been studied extensively and the crystal structures of several PGAs had been clarified[2,3]. Combination of rational protein design and site-directed mutagenesis was very effective in elaborating improved PGAs. Interesting progresses such as elucidation of PGA maturation mechanism[4], alteration of kinetic properties and substrate specificity[5] as well as improvement of stability[6] etc., had been reported[7]. Recently, Alkema et al.[8] reported a new procedure to enhance PGA synthetic capability. However, most attempts at redesigning enzymes had failed. In rational redesign, precise changes in amino acid sequence should be predetermined based on a detailed knowledge of protein structure, function and mechanism, and then introduced using site-directed mutagenesis, but the knowledge needed were not always sufficiently obtained. On the other hand, the function of enzyme was determined by not only the amino acid sequence in the vicinity of the active centers, but also relied on the correct overall conformation of the protein[9]. Recently, method of DNA family shuffling supplied researchers an alternative for developing PGA[10]. DNA family shuffling mimicked and extended classical breeding techniques by recombining more than two parental genes, or genes from different species, in a single DNA shuffling reaction[11]. In this approach, neither structural information nor mechanistic roadmap was required to guide the directed evolution experiment. Moreover, homologous sequences used in DNA family shuffling had been functional evolved during millions of years of natural selection. As a driving force for in vitro evolution via recombination among family genes, DNA family shuffling became a powerful tool for rapidly evolving genes for desired properties[1214].

The PGA producing bacterium Providencia rettgeri (Pr), Escherichia coli (Ec) and Kluyvera citrophila (Kc) belonged to Gram-negative bacteria family. PGAs from these species were evolutionarily related. PrPGA, EcPGA and KcPGA genes were three most closely related pga genes (62.5%96.9% DNA identity) in this highly divergent family. Therefore DNA family shuffling among these three genes could facilitate establishing chimeric pga libraries.

Here we described the cloning of a mutant pga gene from P. rettgeri (ATCC 25599) and its expression in E. coli. A modified DNA family shuffling method was developed to create different interspecies chimeric pools. Mutants were screened, assayed, and then analyzed for the synthesis/hydrolysis(S/H) ratio. The strategy has led to the finding of mutants with evidently improved synthesis capability. It also provides an approach to investigate which domain of PGA is crucial to maintain its catalytic specificity.

 

1    Materials and Methods

1.1   Strains and plasmids

P. rettgeri (ATCC 25599) was purchased from American Type Culture Collection. Plasmids harboring genes of EcPGA and KcPGA were kindly provided by Prof. Gong Yi (Shanghai Research Centre of Biotechnology, shanghai, China) and Dr. Ignatova (Department of Biotechnology II, Technical University of Hamburg, Hamburg, Germany) respectively. pBluescript SK(+) and pUC18 were used as the cloning vectors. E. coli XL1-Blue, TG1 and JM109, the host strains for gene cloning, were cultivated with aeration at 37 in Luria broth (LB). Ampicillin (100 mg/L) and kanamycin (50 mg/L) were added to the medium when strains harboring different recombinant plasmids were selected. The E. coli JM109(DE3) engineering strain was applied for the expression in the medium consisting of 1.5 g/L yeast extract, 0.5 g/L NaCl and 5 g/L glycerol.

1.2   Reagent

The restriction enzymes, Pfu polymerase, dNTP, DNase I, calf intestinal alkaline phosphatase (CIAP), and T4 DNA ligase were purchased from TaKaRa(Dalian, China); all primers were synthesized by SBS(Beijing, China); isopropylthio-beta-D-galactoside (IPTG) was from Sangon (Shanghai, China); 6-nitro-3-phenylacetamino-benzoic acid (NIPAB) was purchased from Dongfeng Reagent Factory (Shanghai, China); the DNA sequencing reactions were conducted by using PRISMTM dye terminator cycle sequencing ready reaction kit (PE Applied Biosystems). Data were collected and analyzed with a ABI PRISMTM 310 DNA sequencer. All the reagents were of AR grade.

1.3   Isolation of PrPGA gene and construction of expression plasmid

P. rettgeri (ATCC 25599) was cultured for 24 h in LB medium for the isolation of chromosomal DNA. Two sets of primers Pr1, Pr3 and Pr2, Pr4 derived from the partial sequence of P. rettgeri (ATCC 31052) were used to amplify segments I and II of pga gene (Table 1). Pr1 contained an initial codon (ATG), whereas Pr4 contained a translational stop coden (TAA). The PCR program: 94 3 min followed by 30 cycles of 94 30 s, 55 30 s, 72 3min, followed by 10 min at 72 . PCR products of segment I and II were blunt-end and ligated into a SmaI digested pBluscript SK(+) vector to construct pSKI and pSKII, and then sequenced. Expression plasmid pETPPGA containing complete pga gene was constructed as following (Fig.1): firstly, pSKII was digested with HindIII and BamHIthe 0.8 kb fragment was cloned into pUC18, which had been cleaved with the same enzymes. After digestion with NdeI and SalI, a 0.2 kb fragment of this resulting plasmid pUCII was substituted by the 1.5 kb NdeI/SalI fragment of pSKI to form pPPGA. Full-length pga gene of pPPGA was sequenced and submitted to GenBank and the accession number was AF499615. Plasmid pPPGA was digested with NdeI and BamHI, and the 2.5 kb fragment containing pga gene was inserted into pET24a(+) to form the expression vector pETPPGA.

 

Table 1   DNA sequence of used primers

Primer

DNA sequence (5'-3')

Restriction sites

Corresponding PGA gene

Pr1

cgaattccatatgaaaaaacacctcatc

NdeI

Pr

Pr2

gccgtgtcgaccttaatcatc

SalI

Pr

Pr3

gattaaggtcgacacggctag

SalI

Pr

Pr4

ttggatccttagaccttaatcatcaatgt

BamHI

Pr

Pr4’

ttggatccctatctctcaattattagtg

BamHI

Pra

Pr5

TCACCCACATATTGCTGGTGGTTGGGTACCCT

KpnI

Pr

Ec1

cgaattccatatgaaaaatagaaatcgtat

NdeI

Ec, Kc

Ec2

gcgggatccttatctctgaacgtgcaacac

BamHI

Ec, Kc

Ec3

AGGGTACCCAACCACCAGCAATATGTGGGTGA

KpnI

Ec, Kc

Primer derived from the partial pga gene sequence of the GenBank M86533. Restriction sites were underlined. Annealing positions of the primers were illustrated in Fig.1(C).

 

1.4   Enzyme activity assay of PGA

PGA activity was assayed by modified colorimetric method[2]. One unit of enzyme was defined as the amount of enzyme catalyzing the hydrolysis of 1 micromole of NIPAB per minute at 37 .

1.5   DNA family shuffling and construction of pools containing different chimeric sequences

PrPGA, EcPGA and KcPGA genes were amplified by PCR. DNase I was used to fragment 10 μg of such PCR products; 100250 bp fragments were isolated from 2% agarose gel as Zhao et al.[15] described. Then PCR reassembly without primers was carried out as program: 3 min 94 followed by 45 cycles of 94 30 s, 37 30 s, 72 1 min + 3 s/cycle (the duration of the elongation step was increased by 3 s after each cycle), followed by 10 min elongation at 72 . The PCR products were subsequently subjected to 25 cycles of PCR with five primer pairs. The entire chimerical coding region of PGA(CH1-AB), α subunit coding region (CH1-A), β subunit coding region (CH1-B), 5’-half of the CH1-B (CH1-B1) and 3’-half of the CH1-B (CH1-B2) were amplified respectively. After digested by corresponding restriction enzymes, these fragments substituted for relative segments of pETPPGA resulting in various chimeric libraries.

1.6   Screening for chimeric enzymes with PGA activity

For colonies screen, the filters paper were saturated with 2% NIPAB and dried beforehand. The plasmids containing various chimeric genes were introduced into JM109 (DE3) by electroporation. Agar plates containing 50 mg/L kanamycin were plated with transformants, incubated at 37 for 18 h and imprinted with NIPAB filter paper. The filter paper was removed from plate after being soaked, and then was kept at 37 for 10 min. The visible yellow halos on the filter paper indicated the colonies expressing active PGA. Positive colonies were selected and cultured. IPTG was added when A600=0.6 and the fermentation continued for 3 h. The mutant enzymes were isolated by a modified osmotic shock method and the activities were assayed[2]. Colonies with higher activity were selected and the nucleotide sequences of the inserts were determined.

1.7   Assay the synthesis to hydrolysis (S/H) ratio

Enzymatic conversions of cephalexin were carried out with D-phenylglycinamide and 7-amino-deacetoxycephalosporanic acid (7-ADCA) as substrates. S/H ratios were determined according to the previous paper[16].

 

2    Results

2.1   Isolation and characterization of the gene

Two oligonucleotides Pr1 and Pr4’ were synthesized according to pga sequence (GenBank M86533) derived from P. rettgeri (ATCC 31052). Unfortunately, it was not successful to amplify full-length pga sequence of P. rettgeri (ATCC 25599). To improve PCR efficiency, the internal primer pairs Pr2/Pr3 were designed to contain a SalI site and used in following segment amplification. Two truncated segments, designated I and II[Fig.1(A)] respectively, were successfully amplified, and both sequences showed high similarity with published pga[17]. However, it was found that Pr4’ was not complementary to the DNA sequence of 3'-terminus of segment II, although Pr2 complemented to both the 5'-and 3'-terminal DNA sequence of segment II. In another word, Pr2 was the upstream primer as well as the downstream one in amplifying segment II. Therefore, a new PCR primer Pr4 was synthesized by adding a translational stop codon and a BamHI site at 3'-terminus of Pr2. The newly generated segment II was ligated with segment I at SalI restriction site to construct the plasmid pPPGA. Traditional expression vectors contain a β-lactamase gene which interferes with β-lactam acylase assay. Therefore, plasmid pETPPGA containing a kanamycin resistance marker was constructed and transformed into E. coli JM109(DE3)[Fig.1(B)]. The engineering organism showed to produce the active enzyme.

The open reading frame of 2514 bases encoded an 837 amino-acid protein of PGA. The full sequence of the enzyme exhibited high similarity with the published PGA of P. rettgeri (ATCC 31052). These enzymes share 92.8% protein sequence identity (59 different amino acids) and 90.2% DNA sequence identity[18].The failure in gene amplification with primer Pr1 and Pr4’ indicated that C-termini of these two genes were significantly different. DNA and amino acids sequence alignments of α and β subunits from EcPGA, KcPGA with those of the generated PrPGA showed that the generated PrPGA shares a high identity with EcPGA (62.6% in protein sequence and 61.8% in DNA sequence) and KcPGA (60.6% in protein sequence and 60.0% in DNA sequence).

2.2   Family shuffling with randomly cleaved fragments

The probability of homo-duplex formation in family shuffling was much higher than that of hetero-duplex formation because of the high divergence between parents. In order to improve the efficiency of chimeric formation in family shuffling, hetero-primers were designed to generate chimeric sequences in different PCR. As described in Table 1 and Fig.1(C), Pr1, Ec1 and Pr4, Ec2 were external 5' and 3' primers with restriction sites of NdeI and BamHI, respectively. Pr2 and Ec3 were internal 5' primers, whereas Pr3 and Pr5 were internal 3' primers. Each of them contained a unique restriction site of SalI or KpnI, respectively. After random fragmentation and then reassembly, chimeric sequences were generated by PCR from a pool of reassembly using primers Ec1/Pr4 (Fig.2). The chimeric sequences were inserted into pETPPGA by digestion of NdeI and BamHI. Other chimeric sequences were generated and cloned in similar way. It should be noted that a chimeric primer of Ec3 was designed. Its 5’ half had the same sequence as that of PrPGA containing a KpnI site, and its 3’ half had the same sequence as that of Ec/KcPGA. This design was based on the fact that there are identical amino-acid sequences in near β subunit of above PGAs. Thus the KpnI site could facilitate the following DNA manipulation.

Fig.1       Strategy of primer design, gene cloning and expression vector construction

(A) Cloning strategy for PrPGA. (B) Construction of the expression plasmid pETPPGA. For details to see materials and methods. (C) Sketch map of various pga genes and corresponding primers.

 

Fig.2       DNA shuffling procedure to generate full-length gene of CH1-AB

1, fragmentation; 2, reassembly; 3, amplification with primers Ec1 and Pr4; 4, reamplification with the same primers; M, the molecular masses of the marker DL2000.

 

By electroporation, ligation product containing chimeric gene were introduced into JM109(DE3) with a transformation efficiency about 105. However, the efficiency was far higher when JM109 or TG1 was applied as host strains. Unfortunately, the latter libraries have to be first retrieved and transformed JM109(DE3) to express PGA. Because repeated transformation might decrease the diversity of chimeric pools, direct transformation was employed in this paper.

2.3   Construction and analysis of chimeric libraries

Generally, α and β subunits of PGA are structurally and functionally independent. A covalent internal spacer forces the α subunit (A) and β subunit (B) to bind together(Fig.1). In order to achieve high gene diversity, the chimeric sequence libraries of CH1-AB, CH1-A and CH1-B were constructed separately and then screened for PGA activity (Table 2). There are few active mutants from these libraries except for CH1-A. Since homologous PGAs differ in gene lengths and gaps, DNA crossover events occurring among gene gaps will have a big chance to generate mutants with shifted reading frame. In order to avoid this problem, we created shortened versions of CH1-B, CH1-B1 (5'-half of β subunit) and CH1-B2 (3'-half of β subunit). As shown in Table 2, library of CH1-B2 domain generated much higher percentage of active mutants than the others. This indicated this domain was probably less sensitive to mutagenesis and could tolerate high mutation densities

 

Table 2   Construction and analysis of different chimeric libraries

Chimeric sequences

Coding region

Primers used

Restriction site contained

Number of screened clone

Positive%

CH1-AB

Full length gene

Ec1/Pr4

NdeI/BamHI

~5×104

0

CH1-A

α subunit

Ec1/Pr5

NdeI/KpnI

~1×104

2.8

CH1-B

β subunit

Ec3/Pr4

KpnI/ BamHI

~5×104

0.3

CH1-B1

5' half of β subunit

Pr3/ Ec3

KpnI/SalI

~1×104

2.1

CH1-B2

3' half of β subunit

Pr2/ Ec2

SalI/BamHI

~1×104

23.5

 

2.4   Analysis of β-lactam antibiotic synthetic activity and gene diversities

85 chimeric PGAs were assayed for S/H ratio. As shown in Fig.3(A), these mutants exhibited marvelous diversity. The best one with the S/H ratio of 10.74 possessed a synthetic activity 40% higher than PrPGA (7.65). It was observed that mutants from library CH1-A1 were more favorable than those from CH1-B1 and CH1-B2. 66% of colonies (25/39) in library CH1-A1 had higher S/H ratios than that of PrPGA. On the contrary, only 30% colonies of CH1-B1 (5/17) and CH1-B2 (9/30) libraries had higher S/H ratios than that of PrPGA[Fig.3(B)].

Fig.3       Screen of the chimeric libraries reveals improved clone

(A)All of the active clones were screened for S/H ratio. , enzyme mutant; , PrPGA. (B) Evaluation of different libraries. Mutants from , CH1-A1; , CH1-B1; , CH1-B2. Symbols in darkness represented PrPGA.

 

As shown in Table 3, totally 7 mutants were selected and sequenced. Among these mutants, CH1-A-1, CH1-A-2, CH1-B2-1, CH1-B1-1 and CH1-B1-2 were best mutants from each library. CH1-B2-2 and CH1-B2-3 were randomly selected from CH1-B2 library. Gene sequences analysis demonstrated all the chimeras had a crossover at different positions. It was the fact that none of the chimaeras possessed the same gene length and identical DNA sequence, which might account for such significant diversity (Fig.4). The chimaeras were constructed using the DNA sequence of PrPGA as backbone. There were only small percentages replaced by EcPGA or KcPGA in the whole DNA sequence of PrPGA segment. This implied PrPGA contributed more to chimaeras properties. This might be the reason that most of mutants had lower S/H ratios than parent enzymes of Ec (10.39) and Kc (8.56).

Fig.4       Phylogenetic tree of the wild type and mutant genes

A dotted line indicated a negative branch length resulted from averaging. DNA sequences were compared using the DNA-star Megalign program (DNA-Star, Madison, WI).

 

Table 3   Chimeric PGA sequences of selected active colonies

Mutants

Amino acid sequence of chimeric mutants a

Length of gene (bp)

Number of point mutations

Length of overlap area (bp)

S/H ratio

CH1-A-1b

Kc1-50, Pr46-837

2529

0

14

10.74

CH1-A-2

Ec1-182, Pr178-837

2529

1

14

10.41

CH1-B2-1

Pr1-686, Ec688-843

2531

3

15

9.85

CH1-B1-1

Pr1-284, Kc290-507, Pr504-837

2514

3

17

9.68

CH1-B1-2

Pr1-284, Kc290-529, Pr526-837

2514

3

8

9.38

CH1-B2-2

Pr1-749, Ec751-844

2535

4

18

8.34

CH1-B2-3

Pr1-739, Ec741-844

2535

4

9

7.58

 

Besides significant efficiency to form chimeric gene, family shuffling in the study also exhibited remarkably high efficiency of producing point mutation. The overall mutagenic rate in this study reached at 0.38% (18/4690). It also showed that the gene recombination and crossover was prone to occur at the regions with higher similarity. The length of overlap between parent sequences was crucial to form chimeric genes, and in this experiment, it was found that a crossover was observed at the sequences within 8 bases identities.

 

3    Discussion

For rational enzyme design, those amino acid residues located close to the active center or binding pocket etc. are often modified because they are more 'logical' to altering the three-dimensional structure. Evidently, it is more difficult to demonstrate functions of amino acids located far away from the place where the reaction takes place. For example, Sizmann et al.[19] found that maturation process towards alteration at the extreme C-terminus of the E. coli PGA precursor was highly sensitive. These results indicated that some 'unimportant' mutations might prevent PGA proper folding or correct processing. On the other hand, some 'unimportant' mutations would significantly affect the catalytic properties of an enzyme[20]. In sharp contrast to rational design, DNA family shuffling permuted blocks of sequence containing conservative amino acid substitutions that had been selected for function during millions of years of natural selection. Shuffling of gene families did not require information about how enzymes structure was related to function and would accelerate the evolution process.

Family shuffling always involves the problem of reassembling the gene fragments into parental gene sequences and prevents the formation of chimeric sequences. Generally, a highly efficient screening procedure was required to overcome this problem[21]. When attractive selection methods were not available, creating chimeric sequences by utilizing hereto-primer did become an alternative. In this study, efficiency of recombination was improved using hetero-primers. This manipulation eliminated background produced by parental gene. The diversity in the libraries in this study was overwhelmingly generated by recombination of preexisting natural sequence diversity in the gene family.

Our results indicated pga gene could tolerate high mutation densities and derived much more chimeras from diverse species. To evaluate functions of these segments exchanges and point mutations, molecular modeling of evolved mutants was being carried out. Resulted information could be used to minimize the sequence space that must be searched or to suggest targets for further site-directed mutagenesis. The strategy described here represented an applicable and promising route to improving the PGA synthetic activity. Further work could surely help to increase the understanding on structure/function relationships of PGA. Increased S/H ratios of mutants to higher levels by multiple-cycle DNA family shuffling were expected in future research.

 

References

1     Wu XJ, Yang S, Wang Z, Zhan XZ, Yuan ZY. Enzyme engineering in the industrial production of β-lactam antibiotics. World Sci-Tech R&D, 2001, 23(1): 3943

2     Kutzbach C, Rauenbusch E. Preparation and general properties of crystalline penicillin acylase from Escherichia coli ATCC11105. Hoppe Seylers Z Physiol Chem, 1974, 355(1): 4553

3     Klei HE, Daumy GO, Kelly JA. Purification and preliminary crystallographic studies of penicillin G acylase from Providencia rettgeri. Protein Sci, 1995, 4(3): 433441

4     Choi KS, Kim JA, Kang HS. Effects of site-directed mutations on processing and activities of penicillin G acylase from Escherichia coli ATCC 11105. J Bacteriol, 1992, 174(19): 62706276

5     Martin J, Prieto I, Barbero JL, Perez-Gil J, Mancheno JM, Arche R. Thermodynamic profiles of penicillin G hydrolysis catalyzed by wild-type and Met-Ala168 mutant penicillin acylases from Kluyvera citrophila. Biochim Byiophys Acta, 1990, 1037(2): 133139

6     Yang S, Huang H, Li SY, Ye YZ, Wan L, Zhang FW, Yuan ZY. Enhancing penicillin G acylase stability by site-directed mutagenesis. Acta Biochim Biophys Sin, 2000, 32(6): 581585

7     Van Laan JM, Riemens AM, Quax WJ. Mutated penicillin G acylase genes. US Patent: 006033823A. 2000-03-07

8     Alkema WB, Dijkhuis AJ, Vries E, Janssen DB. The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase. Eur J Biochem, 2002, 269(8): 20932100

9     Chen RD. Enzyme engineering: Rational redesign versus directed evolution. Trends Biotechnol, 2001, 19(1): 1314

10    Crameri A, Raillard SA, Bermudez E, Stemmer WP. DNA shuffling of a family of genes from diverse species accelerates directed evolution. Nature, 1998, 391(6664): 288291

11    Stemmer WP. Rapid evolution of a protein in vitro by DNA shuffling. Nature, 1994, 370(6488): 389391

12    Ness JE, Welch M, Giver L, Bueno M, Cherry JR, Borchert TV, Stemmer WP et al. DNA shuffling of subgenomic sequences of subtilisin. Nat Biotechnol, 1999, 17(9): 893896

13    Chang CC, Chen TT, Cox BW, Dawes GN, Stemmer WP, Punnonen J, Patten PA. Evolution of a cytokine using DNA family shuffling. Nat Biotechnol, 1999, 17(8): 793797

14    Christians FC, Scapozza L, Crameri A, Folkers G, Stemmer WP. Directed evolution of thymidine kinase for AZT phosphorylation using DNA family shuffling. Nat Biotechnol, 1999, 17(3): 259264

15    Zhao H, Arnold FH. Optimization of DNA shuffling for high fidelity recombination. Nucleic Acids Res, 1997, 25(6): 13071308

16    Zhou Z, Zhou LP, Chen MJ, Zhang YL, Li RB, Yang S, Yuan ZY. Purification and characterization of Alcaligenes faecalis penicillin G acylase expressed in Bacillus subtilis. Acta Biochim Biophys Sin, 2003, 35(5): 416422

17    Ljubijankic G, Konstantinovic M, Glisin V. The primary structure of Providencia rettgeri penicillin G amidase gene and its relationship to other gram negative amidases. DNA Seq, 1992, 3(3): 195200

18    Zhou Z, Zhang AH, Zhou LP, Yang S, Jiang YM, Yuan ZY. Cloning and expression of penicillin G acylase gene from Providencia rettgeri in Escherichia coli. Industrial Microbiology, 2002, 32(3): 15

19    Sizmann D, Keilmann C, Bock A. Primary structure requirements for the maturation in vivo of penicillin acylase from Escherichia coli ATCC 11105. Eur J Biochem, 1990, 192(1): 143151

20    Spiller B, Gershenson A, Arnold FH, Stevens RC. A structural view of evolutionary divergence. Proc Natl Acad Sci USA, 1999, 96(22): 1230512310

21    Coco WM, Levinson WE, Crist MJ, Hektor HJ, Darzins A, Pienkos PT, Squires CH et al. DNA shuffling method for generating highly recombined genes and evolved enzymes. Nat Biotechnol, 2001, 19(4): 354359

 


Receive: February 19, 2003   Accepted: March 24, 2003

This work was supported by the grants from the National Natural Science Foundation of China (No. 30100029) and the National High Technology Research and Development Program of China (863 Program) (No. 2001AA235081)

*Corresponding author:

YUAN Zhong-Yi: Tel, 86-21-54921246; Fax, 86-21-54921011; e-mail, zyyuan@sibs.ac.cn

YANG Sheng: Tel, 86-21-64042090-4720; e-mail, syang@sibs.ac.cn