http://www.abbs.info e-mail:abbs@sibs.ac.cn

ISSN 0582-9879                                          ACTA BIOCHIMICA et BIOPHYSICA SINICA 2003, 35(9): 864–872                                    CN 31-1300/Q

 

Short Communication

Sequence and Expression of a cDNA Encoding Both Pituitary Adenylate Cyclase Activating Polypeptide and Growth Hormone releasing Hormone in Grouper (Epinephelus coioides)

JIANG Yong, LI Wen-Sheng, XIE Jun, LIN Hao-Ran*

( Institute of Aquatic Economical Animal & Guangdong Provincial Key Laboratory for Aquatic Economical Animal, Zhongshan University, Guangzhou 510275, China )

 

Abstract        Both pituitary adenylate cyclase activating polypeptidePACAP and growth hormone-releasing hormone GHRH belong to the vasoactive intestinal polypeptide-glucagon-secretin family. They are encoded on the same gene in vertebrates (birds, amphibian, fish). Although the gene encoding PACAP and GHRH has been cloned in other fish species, characterization of this gene in the commercially important grouper (Epinephelus coioides) has not been previously reported. In this study, the GHRH/PACAP cDNA was cloned from grouper hypothalamic tissue. Two cDNA variants of the GHRH/PACAP precursor gene were identified as a result of alternative splicing, a long form encoding both PACAP and GHRH and a short form encoding only PACAP. Both the long and the short forms of the GHRH/PACAP precursor cDNA were identified in grouper 22 tissues as well as expression in embryos and larvae by semi-quantitative RT-PCR detection. PACAP / GHRH precursor mRNA was expressed at a high level in the central nervous system than in several peripheral tissues. The data presented here provide the report of PACAP/GHRH mRNA expression in eye and gill tissues in fish. PACAP/GHRH mRNA was expressed in grouper embryo and all larval stages examined and was expressed at a high level starting on neurula stage onwards. The result suggests that PACAP/GHRH had an important role in the development of embryos and larvae, especially in neurula appearance stage.

 

Key words     grouper (Epinephelus coioides); pituitary adenylate cyclase-activating polypeptide (PACAP); growth hormone-releasing hormone (GHRH); tissue distribution; semi-quantitative RT-PCR

 

Pituitary adenylate cyclase-activating polypeptide (PACAP) was first isolated from ovine hypothalamic extracts based on its ability to stimulate adenylate cyclase in rat pituitary cell cultures[1]. Two molecular form of PACAP have been identified: a 38 amino acids form (PACAP-38) and a form comprised of the 27 N-terminal amino acids of PACAP-38 (PACAP-27)[2]. Evidence indicates that both forms of PACAP are derived from the same gene and mRNA precursor[3]. Growth hormone releasing hormone (GHRH) was first isolated from a human pancreatic tumour that caused acromegaly based on its ability to stimulate growth hormone release[4, 5]. GHRH is primarily produced in the hypothalamus and acts on the pituitary to cause the release of growth hormone from somatotrophs[6]. In addition, GHRH is produced in peripheral tissues such as the testis and ovary, and in the brain during development[79]. An increase in cAMP is the main mechanism by which GHRH acts. Both GHRH and PACAP belong to the vasoactive intestinal polypeptide-glucagon-secretin family. They are encoded on the same gene in vertebrates (birds, amphibian, fish) as well as in the invertebrate tunicate[10, 11]. But in mammals, the two peptides are encoded on separate genes. PACAP is the highly conserved member of this family. Conservation during the evolution from protochordate to mammals has yield a 96% amino acid sequence identity between mammalian and tunicate PACAP-27[10]. In contrast, GHRH is only moderately conserved.

The PACAP gene and/or cDNA have been cloned from human[1214], sheep[12], rat[15], mouse[16], chicken[11], frog[17, 18], salmon[19, 20], catfish[21], goldfish[22], zebrafish[9] and tunicate[10]. Recently, using an in vitro cell perifusion system, PACAP was shown to induce growth hormone (GH) and gonadotropin (GtH) release from goldfish and common carp pituitary cell in a dose-dependent manner, suggesting that PACAP may be involved in seasonal regulation of body growth and reproduction in fish[23, 24].

The groupers (Epinephelus) are highly priced and popular marine cultured fish in China and Southeast Asia countries. However, the grouper larvae growth is slow, high mortality may be occurred in 1420 days post hatch. In this paper, the coding region of a gene encoding PACAP and GHRH precursor were synthesized by RT-PCR from total RNA of the grouper (Epinephelus coioides) hypothalamic tissue, and we also examined the presence of PACAP and GHRH mRNAs in embryos and changes in its expression in early development and tissue distribution in the central nervous system and several peripheral tissues by semi-quantitative RT-PCR. Our research objective will be further expanded to examine the potential applications of PACAP in marine aquaculture, in particular, we will focus on the possible use of gene recombinant PACAP as a new growth-promoting supplement of fish feed and a new additive of ovalutory agent for induced spawning in the groupers.

 

1   Materials and Methods

1.1 Grouper total RNA extraction and reverse transcriptase-polymerase chain reaction

Total RNA was extracted using Trizol (Invitrogen/Life Technologies, Burlington, ON) based on the guanidium thiocyanate-phenol-chloroform method of extraction. The concentration of the total RNA was estimated by measuring the absorbance at 260 nm. First strand cDNA was then reverse-transcribed from 5 μg of total RNA using SuperscriptTM First-Strand Synthesis system (Gibco BRL) following the manufacturers’s protocol. Two degenerate sense primers and one antisense primer for nested PCR reaction were used to amplify the internal region of grouper PACAP/GHRH cDNA (Table 1). The design of these primers was based on the most conserved amino acid sequences in known teleost PACAP/GHRH. The 50 μl first PCR reaction mixture consisted of 2 μl first strand cDNA (template), 1.5 μl of 10 μmol/L P1 and P3, 0.8 mmol/L dNTP mix, 1.25 u Taq DNA polymerase (Gibco BRL) in 5 μl of 10× Taq buffer, 0.8 mmol/L MgCl2. PCR was carried out for 3 min denaturation (94 ℃), followed by 25 cycles of 45 s denaturation (94 ℃), 30 s primer annealing (55 ℃), 1 min and 30 s primer extension (72 ℃), and a final extension for 10 min. 1 μl first round PCR product was removed and amplified again under the same conditions except using P2 instead of P1. PCR products of the expected size were separated by electrophoresis using a 1.7% agarose gel. The anticipated band was purified using E.Z.N.A.Gel Extraction Kit (Omega D2501-02).

 

Table 1   Primers used in cloning grouper PACAP/GHRH cDNA(5′3')

(1) Degenerate primers for cloning the internal region
P1: GCA
GTGAGCACAAGT)(AGTCTAGTAAGAGCGTACT
P2: GA
AGAAGGAAGCGCGAAAGCGCATGCAG
P3: TA
AGC)(AGCCACTAAG)(GCTCGAGCCGTCCTTTG

(2) Primers for cloning the 3-end
Adapter primer (AP): GGCCACGCGTCGACTAGTACTTTTTTTTTTTT-TTTTT
Universal amplification primer (UAP): CUACUACUACUAGGCCACGC-GTCGACTAGTAC
P4: ATTAGATAGAGCCTTGAGGGAAGAT
P5: AGCCCTTATCCAAAAGACATTCAGA

(3) Primers for cloning the 5-end
Abridged anchor primer: GGCCACGCGTCGACTAGTACGGGIIGGGII-GGGIIG
Abridged universal amplification primer (AUAP): GGCCACGCGTCGA-CTAGTAC
P6: CGTCCTTTGTTCCTAACTCTCTGTC
P7: TTCCCAGAACCGCTGCCAGGTATTTP8: TCTTTTGGATAAGGGCTCTGACTCT

(4) mRNA expression primers
P9: CTCGTCTACGGAATCTTAATGCACTA
P10: TTTGTTCCTAACTCTCTGTCT
β-actin F : TCTCCATCCACGTCGGCCAG;
β-actin R : TAAGTGCCCGTGCGAACCTC

 

3′-RACE reactions were performed using AP, P4, P5 and UAP (Table 1), the PCR product was extracted, gel purified as previously described. 5′RACE reactions were done over two rounds. P7 and AUAP were primers in the first round PCR. In second round reactions, 2 μl of the first round PCR product was regarded as template while P8 and AUAP as primers. All PCR reactions ran for 25 cycles with a 10 min extension at 72 ℃ on the last cycle. Annealing temperatures used for nested PCR was 55 ℃. Each primer is indicated in Table 1. RACE PCR products were visualized by staining the gels in ethidium bromide and viewed with the BioRAD Gel Doc 2000. Ligation into pGEM-T easy vector (Promega, Madison, WI) was performed using the PCR products isolated from the agarose gels using E.Z.N.A.Gel Extraction Kit according to the manufacturer’s instructions. DNA was transformed and processed. After enzyme digestion with Eco RI (TaKaRa, Japan), preparations with inserts of expected size were sequenced.

Samples of 20 eggs and embryos at each stage of embryogenesis were pooled and immediately frozen in liquid nitrogen. Adult grouper, egg, embryo and larvae were obtained from Daya bay aquaculture center.

1.2 Sequence analysis

DNA sequences were analyzed with the BLASTn program available from the NCBI internet website. Protein translations were done and analyzed with the same source and the programs BLASTx or BLASTp. Multiple alignments of cDNA and amino acid sequences were performed with the programs CLUSTAL and ALIGN. Phylogenetic analysis was conducted with the Treeview program and Clustalx with 0.1.

1.3 Tissue distribution

The RT-PCR was validated by running PCR reactions for different cycles and different concentration to determine the cycle number and concentration for each gene that generates half maximal PCR product. After an initial denaturation for 3 min at 94 °C, the reaction was performed on the Thermal Controller PTC-200 (MJ Research, Watertown, MA) with the cycling profile of 45 s at 94 °C, 30 s at 4560 °C, and 90s at 72 °C followed by a 10 min extension at 72 °C. Primers see Table 1. After the determination of the cycle number, the PCR reactions were performed with the template concentration from 50350 ng. PCR reaction (5 μl) was electrophoresed on agarose gel containing ethidium bromide to visualize the products and the yield of PCR products was quantitated with the Gel Doc 2000 (BioRAD).The specificity of the reactions was confirmed by cloning the PCR products into pGem-T-easy victor and sequenced. The PCR for β-actin was performed to serve as an internal of control in mRNA concentration in the RT reaction with the annealing temperature 60 ℃.

Distribution of the grouper GHRH/PACAPprecursor mRNAs were examined by RT-PCR withprimers P9 and P10 in embryos and early development. First-strand cDNA was prepared from total RNA by treated with DNase. PCR conditions were 30 cycles of 94 °C for 90 s, 55 °C for 45 s, and 72 °C for 90 s, followed by a final extension at 72 °C for 10 min. For an internal control, RT-PCR was performed at the same time with the primer for grouper β-actin with annealing temperature 60 °C. PCR products were separated on 1.4% agarose gels containing ethidium bromide and detected under ultraviolet light with the Gel Doc 2000 (BioRAD) and analyzed with Quantity one Tutorial-Quantity standards.

 

2   Results

2.1 Isolation of grouper GHRH/PACAP precursor cDNA

A single cDNA fragment of 288 bp was isolated from grouper hypothalamic tissue by nested PCR with P2 and P3. Two fragments of 351 and 456 bp were isolated with P7 and P8, respectively (Fig.1). The two products isolated with primers P7 and P8 differed only in their deletion or retention of exon 4, respectively. One clone containing exon 4 and another with exon 4 deleted were amplified by 5′ RACE PCR and sequenced. The grouper precursor cDNA contained a signal peptide from 338398 bp (120 aa), GHRH from 651785 bp (85128 aa), and PACAP from 792843 bp (131168 aa). Grouper PACAP is preceded by a dibasic amino acid enzyme processing site (Lys-Arg) and is followed by a Gly-Arg-Arg processing site which would yield a 38 amino acids peptide with an amidated C terminus. Processing at a second amidation site within the PACAP sequence would result in the 27 amino acids PACAP. Organization of the grouper gene is very similar to that of the channel catfish. Grouper GHRH is preceded by a threonine with a dibasic Lys-Arg site 3 amino acids upstream and followed by a Lys-Arg site at the C terminus (Fig.2).

 

 

Fig.1      Results of RT-PCR GHRH/PACAP precursor cDNA in the hypothalamus of grouper

(A) Precursor cDNA 288 bp fragment; (B) 3′ RACE PCR production; (C) 5′ RACE PCR production. M, 100 bp marker; 1, first round PCR; 2, 3, 4, nested PCR.

 


Fig.2      Nucleotide sequence of the grouper GHRH/PACAP precursor cDNA and deduced amino acid sequence

The sequence encoding GHRH is singly underlined and the sequence encoding PACAP is doubly underlined. Alternate splicing results in the deletion of nucleotides (italics).

 

2.2 Distribution of PACAP/GHRH and their precursor’s alternative splicing

Semi-quantity RT-PCR assays were developed for measuring the levels of expression of PACAP and GHRH. Series of RT-PCR reactions were performed for PACAP/GHRH and β-actin. The reactions were sampled at different cycles and concentration and analyzed by electrophoresis. The cycle number that generates half maximal reaction was chosen for quantitating the expression of each gene in all the following experiments, i.e. 25 for β-actin and 30 for PACAP and GHRH, respectively. To further validate the assays, these cycle numbers were used to amplify serially diluted DNA templates of PACAP/GHRH. The dose of the half maximal reaction is 250 ng.

Two RT-PCR products were isolated in brain (Fig.3) and specific peripheral tissues (Fig.4). Sequence analysis showed that the two bands represent two differently processed mRNA transcripts, resulting in a long and a short GHRH/PACAP precursor cDNA in which 105 bp are missing from the shortened sequence. GHRH/PACAP precursor mRNA expression and alternative splicing were detected in grouper olfactory bulb,telencephalon, hypothalamus, cerebellum, medulla oblongata, spinal cord, pituitary (Fig.3), foregut, midgut, hindgut, muscle, ovary, eye, thymus, heart, liver, head kidney, spleen, kidney,stomach, fat and gill (Fig.4). PACAP/GHRH mRNA was expressed in grouper embryo and all larval stages examined. It was highly expressed starting on neurula stage onwards (Fig.5).

 

Fig.3      Expression of GHRH/PACAP mRNA in the grouper brain and pituitary as detected by RT-PCR

1, marker; 2, olfactory bulb; 3, telencephalon; 4, hypothalamus; 5, cerebellum; 6, medulla oblongata; 7, spinal cord; 8,pituitary; 1016, β-actin; 9, 17, negative control.



Fig.4
     RT-PCR products from peripheral tissues of grouper amplified to detect GHRH/PACAP mRNA expression

1, marker; 2, head kidney; 3, heart; 4, liver; 5, spleen; 6, kidney; 7, ovary; 8, stomach; 9, foregut; 1017, β-actin; 18, marker; 19, midgut; 20, hindgut; 21, fat; 22, gill; 23, eye; 24, muscle; 25, thymus; 2632, β-actin.

 

Fig.5      Expression of GHRH/PACAP mRNA at egg, embryo and larvae

1, marker; 2, unfertilized eggs; 3, fertilized eggs; 4, two-cell; 5, morula stage; 6, blastula stage; 7, gastrula stage; 8, neurula stage; 9, otolith formation stage; 10, new hatching larve; 11, 1st day post hatch (dhp); 12, 2nd dhp; 13, 3rd dhp; 14, 4th dhp; 15, 5th dhp; 16, 6th dhp; 1732, β-actin.

 

2.3 The relationship of the grouper PACAP/GHRH precursor cDNA to the other animals’

In this study, two cDNA variants of the GHRH/PACAP precursor gene in grouper were characterized. Comparison of the grouper PACAP sequence (138 aa) reveals an 89% identity with human PACAP (Table 2); however, grouper GHRH shares only a 52% identity to human GHRH (Table 3). The sequence of GHRH is only somewhat conserved among fish, and chicken (Table 3).

Table 2   Homology of grouper PACAP to published amino acid sequences

 

Identity (%)

Similarity (%)

References

Channel catfish

94

97

[25]

Thai catfish

94

97

[21]

Sockeye salmon

89

97

[19]

Goldfish

74

88

[22]

Zebrafish

92

97

[9]

Frog

86

100

[17]

Chicken

86

97

[11]

Human

89

100

[14]

Sheep

89

100

[12]

Mouse

89

100

[26]

 

Table 3   Homology of grouper GHRH to published amino acid sequence

 

Identity (%)

Similarity (%)

References

Channel catfish

64

77

[25]

Thai catfish

64

77

[21]

Sockeye salmon

55

75

[19]

Goldfish

48

73

[22]

Zebrafish

51

73

[9]

Chicken

51

73

[11]

Human

52

75

[14]

Sheep

45

64

[12]

Mouse

52

76

[26]

 

The comparison of the grouper GHRH/PACAP precursor cDNA sequence with that of Thai catfish and channel catfish demonstrates a high degree of homology between these distant relatives. At the amino acid level, the deduced sequences for the grouper and channel catfish coding regions are highly identical (Fig.6); Comparison of the grouper PACAP sequence (138 aa) reveals a 94% identity with channel catfish PACAP, grouper GHRH shares a 66% identity to zebrafish GHRH. Among the five species presented in Fig.6, alternate splicing has been observed only in grouper, channel catfish and salmon mRNA transcripts.

 

Fig.6      Amino acid alignment of grouper (Epinephelus coioides), channel catfish (I. punctatus), Thai catfish (C. macrocephalus), zebrafish (D. rerio), and sockeye salmon (O.nerka) GHRH/PACAP open reading frames

 

2.4 The phylogenetic relationship of teleostean GHRH/PACAP with that of other vertebrates

To determine the phylogenetic relationship of teleostean GHRH/PACAP with that of other vertebrates, 175 amino acids were compared among channel catfish, Thai catfish, sockeye salmon, zebrafish, chicken, and frog sequences with the Treeview and Clustalx program. Analogous sequence from fish GHRH/PACAP, human PACAP, and human GHRH were included in the phylogenetic analysis to illustrate the possible evolution of PACAP and GHRH peptides.

The resulting phylogenetic tree (Fig.7) showed that grouper GHRH/PACAP is more closely related to that of the channel catfish and Thai catfish than to that of the other species.

Fig.7 Phylogenetic tree of PACAP and GHRH

 

3   Discussion

3.1 Structure of the GHRH/PACAP gene

Structural organization of the grouper GHRH/PACAP precursor gene was determined by comparison to sockeye salmon and Thai catfish and channel catfish cDNA sequences[20, 21, 25]. The insertion or deletion of exon 4 in the grouper gene is consistent with the exon phase in sockeye salmon and channel catfish; however, in Thai catfish alternate splicing was not detected[21]. As observed in sockeye salmon and channel catfish, exon 4 deletion from the grouper precursor mRNA transcript does not change the frame of the downstream amino acid sequence of PACAP[20,25]. The majority of the GHRH sequence is encoded on exon 4, with residues 3345 being encoded on exon 5[27]. Similar to the GHRH/PACAP precursor in nonmammalian vertebrates, the mammalian PACAP precursor gene is composed of 5 exons, with the PACAP coding region located on exon 5[27]. In mammals, however, GHRH is encoded by a separate gene on a separate chromosome, and the sequence of PACAP related peptide is encoded on exon 4 of the PACAP precursor[14, 28].

3.2 Expression of the GHRH/PACAP gene in grouper embryo and larvae

In recent studies on the role of PACAP have focused on the embryonic brain. In situ hybridization histochemistry revealed that the PACAP gene is widely expressed in the neural tube of the mouse at E10.5[29, 30]. PACAP mRNA is found in differentiating neurons, suggesting that PACAP may control proliferation or differentiation of neuroblasts during neural tube development. The presence of high concentrations of PACAP and PACAP receptors in germinative areas of the developing brain indicates that the peptide may exert important functions during ontogenesis of the central nervous system. Indeed, in cerebellar granule cells cultured in conditions promoting apoptosis, PACAP inhibits programmed cell death and stimulates neurite outgrowth[3136]. In chick at embryonic days 3, PACAP mRNA was isolated and sequence from neuroblasts[37]. In rat, PACAP has been detected as early as embryonic day 14(E14)[38]. In mice, PACAP mRNA is present at E9.5[29]. In sockeye salmon, GHRH/PACAP mRNA is expressed at 4 days after fertilization and continues through to hatching[20]. PACAP/GHRH mRNA was expressed in grouper embryos and all larval stages examined and expressed at a high level starting on neurula stage onwards (Fig.5). The expression results suggest that PACAP/GHRH may play an important role in embryos and larvae.

3.3 Distribution of the GHRH/PACAP mRNA expression in grouper tissue

The data presented here provide the report of PACAP/GHRH mRNA expression in eye and gill tissues in fish. The expression of PACAP mRNA in the retina of the human fetus and the adult rat has been detected[3941]. PACAP type I receptor immunoreactivity and mRNA expression have been identified in the retina of the rabbit and rat[31, 41]. These findings along with our result of early and continuous expression, suggest that PACAP/GHRH has a role in the eye. The function of PACAP or GHRH in gill remains to be elucidated.

We found that PACAP/GHRH mRNA was expressed in grouper ovary. Gras et al.[42] showed PACAP mRNA was expressed in the rat ovary during estrus, but not at other stages of the cycle. The variable PACAP mRNA expression in the adult ovary suggests PACAP expression in this tissue is regulated by the estrus cycle. PACAP mRNA expression was detected in the 2-week-old prepubescent ovary, suggesting a role in maturation of this reproductive organ. PACAP has also been shown to be involved in meiotic maturation of rat oocytes[43].

In adult grouper, 22 tissues have GHRH/PACAP mRNA distribution. PACAP / GHRH precursor mRNA showed high levels in the central nervous system, and lower but significant contents in several peripheral tissues (Fig.6). Consistent with the distribution in other species, where PACAP / GHRH precursor mRNA expression has been demonstrated throughout the central nervous system and in several peripheral tissues[23, 44]. In the central nervous system, PACAP has been regarded as a neurotransmitter and a neuromodulator, and evidence in fish suggests that it acts as a hypophysiotropic factor regulating pituitary hormone secretion[21]. PACAP also acts as a trophic factor in a number of peripheral tissues[44].

 

References

1     Miyata A, Arimura A, Dahl RR, Minamino N, Uehara A, Jiang L, Culler MD et al. Isolation of a novel 38 residue hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochem Biophys Res Commun, 1989, 164: 567574

2     Miyata A, Jiang L, Dahl RD, Kitada C, Kubo K, Fujino M, Minamino N et al. Isolation of a neuropeptide corresponding to the N-terminal 27 residues of the pituitary adenylate cyclase activating polypeptide with 38 residues (PACAP38). Biochem Biophys Res Commun, 1990, 170: 643648

3     Arimura A, Shioda S. Pituitary adenylate cyclase activating polypeptide (PACAP) and its receptors: Neuroendocrine and endocrine interaction. Front Neuroendocrinol, 1995, 16: 5388

4     Guillemin R, Brazeau P, Bohlen, P, Esch F, Ling N, Wehrenberg WB. Growth hormone-releasing factor from a human pancreatic tumor that caused acromegaly. Science, 1982, 218: 585587

5     Rivier J, Spiess J, Thorner M, Vale W. Characterization of a growth hormone-releasing factor from a human pancreatic islet tumour. Nature, 1982, 300: 276278

6     Mayo KE, Cerelli GM, Rosenfeld MG, Evans RM. Characterization of cDNA and genomic clones encoding the precursor to rat hypothalamic growth hormone-releasing factor. Nature, 1985: 314, 464467

7     Pescovitz OH, Berry SA, Laudon M, Ben-Jonathan N, Martin-Myers A, Hsu SM, Lambros TJ et al. Localization and growth hormone (GH)-releasing activity of rat testicular GH-releasing hormone-like peptide. Endocrinology, 1990, 127: 23362342

8     Bagnato A, Moretti C, Ohnishi J, Frajese G, Catt KJ. Expression of the growth hormone-releasing hormone gene and its peptide product in the rat ovary. Endocrinology, 1992, 130: 10971102

9     Fradinger EA, Sherwood NM. Characterization of the gene encoding both growth hormone-releasing hormone (GRF) and pituitary adenylate cyclase-activating polypeptide (PACAP) in the zebrafish. Mol Cell Endocrinol, 2000, 165: 211219

10    McRory JE, Sherwood NM. Two protochordate genes encode pituitary adenylate cyclase-activating polypeptide and related family members. Endocrinology, 1997, 138: 23802390

11   McRory JE, Parker RL, Sherwood NM. Expression and alternative processing of a chicken gene encoding both growth hormone-releasing hormone and pituitary adenylate cyclase-activating polypeptide. DNA Cell Biol, 1997, 16: 95102

12   Kimura C, Ohkubo S, Ogi K, Hosoya M, Itoh Y, Onda H, Miyata A et al. A novel peptide which stimulates adenylate cyclase: Molecular cloning and characterization of the ovine and human cDNAs. Biochem Biophys Res Commun, 1990, 166: 8189

13   Ohkubo S, Kimura C, Ogi K, Okazaki K, Hosoya M, Onda H, Miyata A et al. Primary structure and characterization of the precursor to human pituitary adenylate cyclase activating polypeptide. DNA Cell Biol, 1992, 11: 2130

14   Hosoya M, Kimura C, Ogi K, Ohkubo S, Miyamoto Y, Kugoh H, Shimizu M et al. Structure of the human pituitary adenylate cyclase activating polypeptide (PACAP) gene. Biochim Biophys Acta, 1992, 1129: 199206

15   Ogi K, Kimura C, Onda H, Arimura A, Fujino M. Molecular cloning and characterization of cDNA for the precursor of rat pituitary adenylate cyclase-activating polypeptide (PACAP). Biochem Biophys Res Commun, 1990, 173: 12711279

16   Miyata A, Sato K, Hino J, Tamakawa H, Matsuo H, Kangawa K. Rat aortic smooth-muscle cell proliferation is bidirectionally regulated in a cell cycle-dependent manner via PACAP/VIP type 2 receptor. Ann N Y Acad Sci, 1998, 865: 7381

17   Alexandre D, Vaudry H, Jegou S, Anouar Y. Structure and distribution of the mRNAs encoding pituitary adenylate cyclase-activating polypeptide / growth hormone-releasing hormone-like peptide in the frog, Rana ridibunda. J Comp Neurol, 2000, 421: 234246

18   Hu Z, Lelievre V, Tam J, Cheng JW, Fuenzalida G, Zhou X, Waschek JA. Molecular cloning of growth hormone- releasing hormone / pituitary adenylate cyclase activating polypeptide in the frog Xenopus laevis brain distribution and regulation after castration. Endocrinology, 2000, 141: 33663376

19   Parker DB, Coe IR, Dixon GH, Sherwood NM. Two salmon neuropeptides encoded by one brain cDNA are structurally related to members of the glucagon superfamily. Eur J Biochem, 1993, 215: 439448

20   Parker DB, Power ME, Swanson P, Rivier J, Sherwood NM. Exon skipping in the gene encoding pituitary adenylate cyclase-activating polypeptide in salmon alters the expression of two hormones that stimulate growth hormone release. Endocrinology, 1997, 138: 414423

21   McRory, JE, Parker DB, Ngamvongchon S, Sherwood NM. Sequence and expression of cDNA for pituitary adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing hormone (GHRH)-like peptide in catfish. Mol Cell Endocrinol, 1995, 108: 169177

22   Leung MY, Tse LY, Yu KL, Chow BK, Wong AO. Molecular cloning and tissue distribution of pituitary adenylate cyclase activating polypeptide (PACAP) in the goldfish. Kwon HB, Joss JMP, Ishii S eds. Rec Progr Mol Comp Endocrinol, Chonnam National University, Republic of Korea: HRC Press, 1999, 383388

23   Wong AO, Li WS, Lee EK, Leung MY, Tse LY, Chow BK, Lin HR et al. Pituitary adenylate cyclase activating polypeptide as a novel hypophysiotropic factor in fish. Biochem Cell Biol, 2000, 78: 329343

24   Xiao D, Chu MM, Lee EK, Lin HR, Wong AO. Regulation of growth hormone release in common carp pituitary cells by pitutiary adenylate cyclase-activating polypeptide: Signal transduction involves cAMP and alcium-dependent mechanisms. Neuroendocrinology, 2002, 76:325338

25   Small BC, Nonneman D. Sequence and expression of a cDNA encoding both pituitary adenylate cyclase activating polypeptide and growth hormone-releasing hormone-like peptide in channel catfish (Ictalurus puntctatus). Gen Comp Endocrinol, 2001, 122: 354363

26   Yamamoto K, Hashimoto H, Hagihara N, Nishino A, Fujita J, Matsuda T, Baba A. Cloning and charaterization of the mouse pituitary adenylate cyclase-activating polypeptide (PACAP) gene. Gene, 1998, 211: 6369

27   Montéro M, Yon L, Kikuyama1 S, Dufour SS, Vaudry H. Molecular evolution of the growth hormone-releasing hormone/pituitary adenylate cyclase-activating polypeptide gene family. Functional implication in the regulation of growth hormone secretion. J Mol Endocrinol, 2000, 25: 157168

28   Perez Jurado LA, Phillips JA Ⅲ, Summar ML, Mao J, Weber JL, Schaefer FV, Hazan J et al. Genetic mapping of the human growth hormone-releasing factor gene (GHRF) using two intragenic polymorphisms detected by PCR amplification. Genomics, 1994, 20: 132134

29   Shuto Y, Uchida D, Onda H, Arimura A. Ontogeny of pituitary adenylate cyclase activating polypeptide and its receptor mRNA in the mouse brain. Regul Pept, 1996, 67: 7983

30   Waschek JA, Casillas RA, Nguyen TB,DiCicco-Bloom EM, Carpenter EM, Rodriguez WI. Neural tube expression of pituitary adenylate cyclase-activating polypeptide (PACAP) and receptor: Potential role in patterning and neurogenesis. Proc Nat Acad Sci USA, 1998, 95: 96029607

31   Cavallaro S, Copani A, D’Agata V, Musco S, Petralia S, Ventra C, Stivala F et al. Pituitary adenylate cyclase-activating polypeptide prevents apoptosis in cultured cerebellar granule neurons. Mol Pharmacol, 1996, 50: 6066

32   Chang JY, Korolev VV, Wang JZ. Cyclic AMP and pituitary adenylate cyclase-activating polypeptide (PACAP) prevent programmed cell death of cultured rat cerebellar granule cells. Neurosci Lett, 1996, 206: 181184

33   Campard PK, Crochemore C, René F, Monnier D, Koch B, Loeffler JP. PACAP type I receptor activation promotes cerebellar neuron survival through the cAMP/PKA signaling pathway. DNA Cell Biol, 1997, 16: 323333

34   Gonzalez BJ, Basille M, Vaudry D, Fournier A, Vaudry H. Pituitary adenylate cyclase-activating polypeptide promotes cell survival and neurite outgrowth in rat cerebellar neuroblasts. Neuroscience, 1997, 78: 419430

35   Villalba M, Bockaert J, Journot L. Pituitary adenylate cyclase-activating polypeptide (PACAP-38) protects cerebellar granule neurons from apoptosis by activating the mitogen-activated protein kinase (MAP kinase) pathway. J Neurosci, 1997, 17: 8390

36   Vaudry D, Gonzalez BJ, Basille M, Pamantung TF, Fontaine M, Fournier A, Vaudry H. The neuroprotective effect of pituitary adenylate cyclase-activating polypeptide on cerebellar granule cells is mediated through inhibition of the CED3-related cysteine protease caspase-3/CPP32. Proc Natl Acad Sci USA, 2000, 97: (24): 1339013395

37   Erhardt NM, Fradinger EA, Sherwood NM,Gervini LA, Rivier JE. Early expression of pitutiary adenylate cyclase-activating polypeptide and activation of its receptor in chick neuroblasts. Endocrinology, 2001, 142: 16161625

38   Tatsuno L, Somogyvari-Vigh A, Arimura A. Developmental changes of pituitary adenylate cyclase activating polypeptide (PACAP) and its receptor in the rat brain. Peptides, 1994, 15: 5560

39   Olianas MC, Ingianni A, Sogos V, Onali P. Expression of pituitary adenylate cyclase-activating polypeptide (PACAP) receptors and PACAP in human fetal retina. J Neurochem, 1997, 69: 12131218

40   Hannibal J, Ding JM, Chen D, Fahrenkrug J, Larsen PJ, Gillette MU, Mikkelsen JD. Pituitary adenylate cyclase-activating peptide (PACAP) in the retinohypothalamic tract: A potential day-time regulator of the biological clock. J Neurosci, 1997, 17: 26372644

41   Seki T, Shioda S, Izumi S, Arimura A, Koide R. Electron microscopic observation of pituitary adenylate cyclase-activating polypeptide (PACAP)-containing neurons in the rat retina. Peptides, 2000, 21: 109113

42   Gras S, Hannibal J, Georg B, Fahrenkrug J. Transient periovulatory expression of pituitary adenylate cyclase-activating peptide in rat ovarian cells. Endocrinology, 1996, 137: 47794785

43   Apa R, Lanzone A, Mastrandrea M, Miceli F, Macchione E, Fulghesu A, Caruso A et al. Effect of pituitary adenylate cyclase-activating polypeptide on meiotic maturation in follicle-enclosed, cumulus-enclosed, and denuded rat oocytes. Biol Reprod, 1997, 57: 10741079

44   Arimura A. Perspectives on pituitary adenylate cyclase activating polypeptide (PACAP) in the neuroendocrine, endocrine, and nervous systems. Jpn J Physiol, 1998, 48: 301331

_______________________________________

Received: March 27, 2003     Accepted: June 23, 2003
This work was supported by the grants from the National High Technology Research and Development Program of China (863 Program) (No. 2001AA621110, No. 2001AA621010), the National Natural Science Foundation of China (No. 39970586) and Guangdong Natural Science Foundation (No. 20023002)

* Corresponding author: Tel, 86-20-84113791; e-mail, ls32@zsu.edu.cn