http://www.abbs.info e-mail:abbs@sibs.ac.cn

ISSN 0582-9879                                        ACTA BIOCHIMICA et BIOPHYSICA SINICA 2002, 34(6): 697-702                                     CN 31-1300/Q

Increasing Bioactivity of Flt3 Ligand by Fusing Two Identical Soluble Domains

LU Chang-Ming, YU Jian-Feng, HUANG Wei-Da1,

ZHOU Xuan, ZHANG Wei-Yan, XI Hong, ZHANG Xue-Guang*

( Biotechnology Research Institute, Soochow University, Suzhou 215007, China;

1 Department of Biochemistry, School of Life Sciences, Fudan University, Shanghai 200433,China )

Abstract    Flt3 ligand (FL) is a hematopoietic growth factor, initiating its intracellular signaling cascade by binding to counterpart receptor and driving receptor dimerization. The native form of soluble FL in vivo is mainly monomeric. In this study, we constructed a rFL-FL fusion protein cDNA by linking two copies of cDNA encoding the soluble domain of FL in tandem and expressed it in Pichia pastoris. On SDS-polyacrylamide gel electrophoresis, the rFL-FL fusion protein showed a molecular weight of 43 kD, agreeing well with the predicted value. The 43 kD protein was further confirmed by Western blot using polyclonal rabbit anti-human FL antibody. The rFL-FL fusion protein exhibited about 10-fold increment in its activity on colony formation of bone marrow progenitor cells. rFL-FL fusion protein also exerted more potent effect than monomeric FL on extending the survival of starving Raji cells.

Key words    rFL-FL fusion protein; linker; Pichia pastoris; hematopoietic colony formation

FL, the ligand for the Flt3 tyrosine kinase receptor, is a hematopoietic growth factor that plays a key role in the growth and differentiation of primitive  hematopoietic cells[1], it is also an important cytokine involved in innate and specific immune response[2,3]. FL shares many characteristics with macrophage colony-stimulating factor (M-CSF) and c-kit receptor ligand (KL). Like M-CSF and KL, there are multiple forms of FL that are generated from alternative transcripts in vivo. The predominant isoform of FL is a transmembrane protein that has a proteolytic cleavage site within the extracellular domain at amino acid 156-157 and is readily cleaved to a soluble protein about 17.686 kD[4-6], which lacks an intermolecular disulfide bond, resulting in dimers associated through noncovalent interactions[7]. Mechanisms by which FL activates its cell surface receptor Flt3 are thought to be similar to those involved in other PDGF receptor family members. It has been proposed that cellular activation by PDGF receptor family is due to the binding of individual subunits of the dimeric ligand to separate receptor molecules that leads to the formation of and/or stabilization of receptor dimers[8]. Mutations that disrupted the dimerization interface were predicted to shift the equilibrium from dimeric to monomeric FL and reduce the biological activity of the mutation protein significantly[9].

The therapeutic potential of recombinant FL was showed by its efficacy in several preclinical animal models. Administration of FL to mice at a dose of  500 mg/kg a day protected mice from a lethal dose of irradiation and lead to a dramatic increase in the number of circulating progenitor cells[10]. Studies in both animal and human also demonstrated that recombinant FL could stimulate the generation in vivo of dentritic cell[11]. It has been suggested recently that FL, administered either alone or in combination with other cytokines in murine model, could effectively inhibit the growth and metastasis of malignancies of liver, lung and breast[3]. However, like KL, FL had an important dose-dependent response, especially in stem cells mobilization. Although FL appears to have a good safety profile, potential toxicity also exists in vivo treatment[12]. Therefore, it is useful to increase the biological activity so as to reduce the dose of FL by generating a stable dimeric FL.

We now report the production of a recombinant fusion protein consisting of two complete human FL molecules in tandem separated by a 15-amino acid linker. The FL-FL fusion protein (rFL-FL) displayed an enhanced bioactivity and therefore would be a more suitable candidate for clinical application.

1  Materials and Methods

1.1  Materials

1.1.1  Plasmid, E.coli strains and FL cDNA    Cloning vector pBluescriptIISK(pSK), and the Escherichia coli strains XL1-Blue, TOP10 were purchased originally from Stratagene(USA), Pharmacia (Sweden) and Invitrogen (USA). The yeast expression system for Pichia pastoris EasySelectTM was purchased from Invitrogen. Synthesis of artificial cDNA encoding human FL was reported previously[13].

1.1.2  Reagents    All restriction endonucleases and T4 DNA ligase we used were purchased from Takara Biotech (Dalian, China). Yeast extract and peptone were from Oxford (USA). Polyclonal rabbit anti-human FL antibody was obtained from Immugenex (USA). ELISA kit for quantitative analysis of FL was purchased from R&D (UK). BM chemiluminescence Western blot kit (mouse/rabbit) was gotten from Boehiringer Mannheim (Germany). Recombinant hFL expressed in E.coli was purchased from Immunex (USA), and used as standard rhFL for bioassay.

1.2  Methods

1.2.1  Construction of FL-FL cDNA    FL-FL fusion protein cDNA was constructed by linking two copies of cDNA corresponding to the soluble domain (1-151 amino acids) of FL ligand through a linker sequence as shown in Fig.1. The first copy (FL-1) was obtained by PCR amplification of FL cDNA[13] using primes FL-1-1 (GAGTGCTC-GAGAAGAGAGAGGCTGAA) and FL-1-2 (GAG-AAGCTTCAAGTGGTCTAGGACT), in which the 151st amino acid codon ACA (Thr) was changed to TCA (Ser) so that a HindIII restriction site was created for cloning. The second copy FL-2 was generated by PCR amplification with primers FL-2-1 (GACTAGGATCCACTCAAGACTGTTCTTTCCA) and FL-2-2 (GTCATTCTAGATCATGGAGCT-GTAGGTGCTG). The linker sequence encoded three repeats of pentapeptide GGGGS, with restriction sites HindIII and BamHI at its 5 and 3 ends. The linker was first cloned into pSK vector and then FL-1 and FL-2 were cloned into the derived pSK-Linker plasmid by restriction sites XhoI/HindIII and BamHI/XbaI, respectively. The derived plasmid was noted as pSK-FL-FL, and confirmed by DNA sequencing on an automatic DNA sequencer.

1.2.2  Expression of FL-FL fusion protein in Pichia pastoris    The FL-FL fusion protein cDNA was subsequently cleaved from pSK-FL-FL with XhoI and XbaI, and introduced into yeast expression vector pPICZaA supplied by Invitrogen, which carries an α factor secretion signal sequence and a Zeocin marker gene for antibiotic selection. The resulted plasmid pPICZaA-FL-FL was then linearized with SacI and introduced into Pichia pastoris by electroporation according to the protocols provided by Invitrogen. Recombinants were selected by plating cells on YPD/Zeocin plates containing 10 g/L yeast extract, 20 g/L peptone, 20 g/L dextrose and 100 mg/L of Zeocin. Colonies that grew on the YPD/Zeocin plates were picked up for screening in BMGY medium[10 g/L yeast extract, 20 g/L peptone, 100 mmol/L potassium phosphate (pH 6.0), 1.34% yeast nitrogen base with ammonium sulfate, 0.4 mg/L of biotin and 1% glycerol], followed by BMMY medium containing the same components as BMGY except for the replacement of 1% glycerol with 0.5% methanol.

Large-scale production of rFL-FL was carried out in 2-L baffled shaker flasks. The transformants were cultured in 250 ml phosphate-buffered BMGY medium shaking at 250 r/min at 30 until A600 reached 2-6. Cells were then harvested by centrifuging at 3 000 g for 5 min, and resuspended in 1 L BMMY medium. Methanol was supplemented every 24 h to a final concentration of 0.5%. For quantitative analysis, aliquots of 1 ml of supernatant were taken at 24, 48, and 72 h and the recombinant protein was quantified by ELISA either immediately or after storage at -20 .

1.2.3  Identification of the recombinant protein    Recombinant protein secreted in the culture media of transformants was analyzed by immunoblotting. Protein samples were separated on SDS-PAGE (12% acrylamide), then transferred onto ployvinylidene difluoride membranes on a semi-dry transfer (Bio-Rad). The membranes were subjected to Western blot analysis with rabbit polyclonal antibody against human FL (Immugenex) as the primary antibody, and horse-redish peroxidase-labelled goat-anti-rabbit IgG as secondary antibody.

1.2.4  Purification of rFL-FL    The supernatants of centrifuged culture media were concentrated by ultrafiltration using 10 kD-molecular cut-off membranes. The concentrated samples were dialyzed overnight at 4 against 20 mmol/L NaAc, pH 5.0, and loaded onto CM-Sepharose Fast Flow (Pharmacia) column preequilibrated with 20 mmol/L NaAc, pH 5.0. The column was developed with a linear gradient of NaCl in 20 mmol/L NaAc, pH 5.0. The peak fractions were pooled and analyzed by SDS-PAGE, followed by Western blot. The purity of rFL-FL was further measured by ELISA together with spectrophotometer.

1.2.5  Bone marrow colony assays    Bone marrow cells were flushed from the femurs of 10-15 week-old female BALB/c mice. Cells were first washed once with RPMI 1640 medium (Gibco, USA) and subjected to separation by Ficoll-Paque (Pharmacia) density-gradient centrifugation at 1 500 r/min for 30 min. The mononuclear cells were plated in 24-well plates with 2×105 cells per well containing 0.5 ml methylcellulose medium. Murine IL-3 (5 mg/L) and mGM-CSF (2 mg/L) were supplemented. Different dilution of rFL-FL, as well as standard FL were prepared for 14 days of incubation at 37 in a CO2 incubator, and colonies mixed (> 40 cells) were enumerated.

1.2.6  Promotion for survival of starved Raji cells    Raji cells were plated in 96-well plates at 104 cells per well in serum-free RPMI 1640 medium, or in the presence of 50 and 200 mg/L of rhFL, or 25 mg/L of FL-FL fusion protein. After 24, 48, 72, 96 and 120 h, the survived cells were counted[14].

2  Results

2.1  Construction of FL-FL fusion protein cDNA

In order to construct DNA fragment encoding FL-FL fusion protein, two copies of DNA fragment encoding the soluble domain of FL (1-151 region of the mature peptide) were amplified from FL cDNA by PCR, and connected by a specially designed linker. In the first copy of FL cDNA (FL-1), restriction enzyme sites XhoI and HindIII were introduced in primers FL-1-1 and FL-1-2 for PCR amplification. In order to create the HindIII site in the reverse primer FL-1-2, the last amino acid Thr (ACA) was changed to Ser (TCA). The linker consists 45 nucleotides encoding three repeats of pentapeptide G-G-G-G-S, which is rich in flexibility. Downstream the linker was the DNA fragment (FL-2) encoding the second FL soluble domain consisting of 156 amino acids, and followed by a stop codon. Restriction site BamHI and XbaI were introduced in primer FL-2-1 and FL-2-2 for amplification of FL-2. FL-1, the linker and FL-2 were cloned and connected by corresponding restriction enzymes in pSK plasmid. The derived plasmid was verified by DNA sequencing and named as pSK-FL-FL. The FL-FL DNA fragment was introduced to the expression vector pPICZaA by restriction enzyme XhoI and XbaI to obtain plasmid pPICZaA-FL-FL. The schematic features and the DNA sequencing as well as the corresponding amino acids are shown in Figure 1, and the results of confirmation by restriction enzyme digestion as well as PCR are shown in Figure 2.

Fig.1  Structure of FL-FL fusion protein cDNA

(A) schematic feature of pPICZaA-FL-FL;  (B) DNA sequence in detail.

Fig.2  Confirmation of pPICZaA-FL-FL by PCR and with restriction endonuclease

M, DNA size markers; 1, 2,  pPICZaA-FL-FL and pPICZaA-rhFL digested by XhoI and XbaI; 3, 4, pPICZaA-FL-FL and pPICZaA-rhFL amplified by primers FL-1-1 and FL-2-2.

2.2  Expression and purification of the rFL-FL

The SacI-linearized pPICZaA-FL-FL was introduced into Pichia pastoris GS115 cells by electroporation. Colonies grew on the YPD/Zeocin plates were first screened for fusion protein expression in BMGY medium under induction with methanol as described in Materials and Methods. Colonies with relatively high expression level of FL-FL fusion protein were chosen for large-scale expression, and the recombinant protein was purified from supernatant by the combination of ultrafiltration and cation-exchange chromatography. The peak fraction eluted at 0.2 mol/L NaCl in 20 mmol/L NaAc (pH 5.0) showed a fuzzy single band of about 43 kD on SDS-PAGE[Fig.3(A), lane 1], and was confirmed to be rFL-FL fusion protein by Western blot[Fig.3(B)]. The purity of rFL-FL was tested to be over 90 percent. Monomeric unglycosylated FL should have a molecular weight of 17.7 kD. Yeast-produced FL migrated at molecular weight of approximately 20-21 kD. This difference is considered to be due to glycosylation at a single N-linked site[9].

Fig.3  SDS-PAGE (A) and Western blot (B) analysis of rFL-FL fusion protein

(A) 1, purified rFL-FL fusion protein; 2, purified rhFL expressed in Pichia pastoris we reported before[13];  M, protein molecular markers. (B) 1, negative control;  2, purified rFL-FL fusion protein.  

2.3  Effect of rFL-FL on colony formation of bone marrow cells

Since human FL has the same effect as murine counterpart on mouse hematopoietic cells, bioassay of rFL-FL was done on colony formation of progenitor cells from mice bone marrow. As expected, rFL-FL showed higher bioactivity than standard rhFL expressed in E.coli (Fig.4). The ED50 of rFL-FL was about 5.2 mg/L (120 pmol/L), whereas the ED50 of standard rhFL was about 23.0 mg/L (1 330 pmol/L). Therefore, the purified rFL-FL was at least 10-fold more potent than rhFL on colony formation.

Fig.4  Effect of rFL-FL and rhFL on colony formation of mouse bone marrow cells

Total number of colonies was scored at day 14. Data are expressed as the mean value of colonies per well (x±s) from three duplicated plates.

2.4  Promotion for survival of starving Raji cells by rhFL and rFL-FL

When serum is deprived from medium, Raji cells will usually go to apoptosis. It was reported previously that FL was able to stimulated the proliferation of Raji cells as a growth factor[15], and the presence of FL will stop apoptosis of Raji cells. Our result showed that rFL-FL was able to promote the survival of starving Raji cells at a significantly lower concentration than rhFL, i.e., 25 mg/L rFL-FL exhibited almost the same protective effect as 200 mg/L rhFL (Fig. 5).

Fig.5  Effect of rFL-FL and rhFL on the survival of Raji cells

Raji cells were incubated in serum-free medium alone (nil) or in the presence of 50, 200 mg/L standard rhFL, and 25 mg/L of purified rFL-FL. The value of survived Raji cells were enumerated at the time indicated. Data are expressed as the mean number of Raji cells (x±s) of five duplicated wells.

3          Discussion

In the present study, we have shown that a fusion protein of two human FL soluble domains linked by a flexible peptide had significantly enhanced bioactivity on colony formation of bone marrow compared with the conventional monomeric FL. There are several possible explanations for this observation. First, it may be due to the increased stability of rFL-FL fusion protein. Second, the enhanced bioactivity may reflect the increase in receptor affinity. Third, and the more reasonable possibility, that the binding of one domain of the rFL-FL fusion protein to its receptor is able to facilitate the binding of the second domain to its receptor, and thus facilitates the dimerization of the FL receptors. The study in KL had shown that bivalent binding of the KL provided the driving force for kit dimerization[16].Covalent dimer of KL exhibited a 10- to 20-fold increase in bioactivity[17]. FL is considered to have the same mechanism, i.e., when FL-FL fusion protein is able to enhance the dimerization of two receptors.

Since the 3-D structure of FL is not determined at present, the length of the linker was designed based on the 3-D model by Graddis et al.[9]. The (GGGGS)3 linker was arbitrarily chosen for its flexibility and also because it had been used previously in constructing single chain antibodies and PIXY-321[18], a linked form of human GM-CSF and IL-3 which had already been used in clinical study. The function of C-terminal amino acids of FL soluble domain was studied by progressive deletions in detail,[16] which revealed that the C-terminal amino acid residues from Cys131 were dispensable for its bioactivity. Therefore, FL-1 was designed to be ended at the 150st amino acid (151st was changed from Thr to Ser), which is 6 amino acids less compared with FL-2. Both FL-1 and FL-2 are expected to be active.

Several studies showed that FL promoted the survival of primitive hematopoietic progenitor cells with myeloid as well as B-cell potential[19,20]. FL and FL-FL also prevent apoptosis of Raji cells (Burkitt's lymphomas). The anti-apoptotic effect of  rhFL and rFL-FL may be performed through modulation of the appotosis-associated protein Bcl-2 and Bax[21].

Pichia pastoris was used for expression of FL-FL fusion protein due to the following advantages: secretory expression helps to get proteins in correct 3-D structure; it secrets very lower level of endogenous protein but higher level of the expressed protein, which can simplify the purification of product; it can perform glycosylation; and with very low level of endotoxin contamination. In order to get high expression of the rFL-FL fusion protein, cDNA of FL was synthesized by using Pichia pastoris-preferred codon usage.

Conclusively, we have successfully construct a human FL-FL cDNA and expressed in Pichia pastoris. The rFL-FL fusion protein was stable and higher in bioactivity compared with conventional FL, and might have a potential clinical application. Other characteristics of rFL-FL, especially its effect on DCs in vivo, are being investigated in our laboratory.

References

1  Lyman SD, James L, Vanden Bos T, de Vries P, Brasel K, Gliniak B, Hollingsworth LT et al. Molecular cloning of a ligand for the Flt3/flk-2 tyrosine kinase receptor: A proliferative factor for primitive hematopoietic cells. Cell, 1993, 75(6): 1157-1167

2  Pisarev VM, Parajuli P, Mosley RL, Chavez J, Zimmerman D, Winship D, Talmadge JE. Flt3 ligand and conjugation to IL-1beta peptide as adjuvants for a type 1, T-cell response to an HIV p17 gag vaccine. Vaccine, 2002, 20(17-18): 2358-2368

3  Lynch DH, Andreason A, Maraskovsky E, Whitmore J, Miller RE, Schuh JC. Flt3 ligand induces tumor regression and anti-tumor immune responses in vivo. Nat Med, 1997, 3(6): 625-631

4  Huang E, Nocka K, Beier DR, Chu TY, Buck J, Lahm HW, Wellner D et al. The hematopoietic growth factor KL is encoded by the Sl locus and is the ligand of the c-kit receptor, the gene product of the W locus. Cell, 1990, 63(1): 225-233

5  Hannum C, Culpepper J, Campbell D, McClanahan T, Zurawski S, Bazan JF, Kastelein R et al. Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature, 1994, 368(6472): 643-648

6  Lyman SD, James L, Johnson L, Brasel K, de Vries P, Escobar SS, Downey H et al. Cloning of the human homologue of the murine Flt3 ligand: A growth factor for early hematopoietic progenitor cells. Blood, 1994, 83(10): 2795-2801

7  Arakawa T,Yphantis DA, Lary JW, Narhi LO,Lu HS,Prestrelski SJ,Clogston Cl et al. Glycosylated and unglycosylated recombinant-derived human stem cell factors are dimeric and have extensive regular secondary structure. J Biol Chem, 1991, 266: 18942-18948

8  Williams LT. Signal transduction by the platelet-drived growth factor receptor involves association of the receptor with cytoplasmic molecules. Clin Res, 1989, 37(4): 564-568

9  Graddis TJ, Brasel K, Friend D, Srinivasan S, Wee S, Lyman SD, March CJ et al. Structure-function analysis of FLT3 ligand-FLT3 receptor interaction using a rapid function screen. J Biol Chem, 1998, 273(28): 17626-17633

10  Brasel K, McKenna HJ, Morrissey PJ, Charrier K, Morris AE, Lee CC, Williams DE et al. Hematologic effects of Flt3 ligand in vivo in mice. Blood, 1996, 88: 2004-2012

11  Pulendran B, Banchereau J, Burkeholder S, Kraus E, Guinet E, Chalouni C, Caron D et al. Flt3-ligand and granulocyte colony-stimulating factor mobilize distinct human dendritic cell subsets in vivo. J. Immunol, 2000, 165: 566-572

12  Juan TS, McNiece IK, Van G, Lacey D, Hartley C, McElroy P, Sun Y et al. Chronic expression of murine Flt3 ligand in mice results  in increased circulating white blood cell levels and abnormal cellular infiltrates associated with splenic fibrosis. Blood, 1997, 90(1): 76-84

13  Xu ZX, Zhu JK, Zhang ZH, Li Y, Lu Y, Huang WD, Zhang XG. Expression of human Flt3 ligand in Pichia pastoris and its biological characteristics. Acta Biochim Biophys Sin, 2000, 32(3): 217-222

14  Meyer C, Drexler HG. FLT3 ligand inhibits apoptosis and promotes survival of myeloid leukemia cell lines. Leuk Lymphoma , 1999, 32(5-6): 577-581

15  Xu Z, Xu Y, Zhu J. Expression of recombinant human soluble Flt3 ligand and its effects on malignant hematopoitic cells. Zhonghua Xue Ye Xue Za Zhi, 2000, 21(11): 595-599

16  Lemmon MA, Pinchasi D, Zhou M, Lax I, Schlessinger J. Kit receptor dimerization is drived by bivalent of stem cell factor. J Biol Chem, 1997, 272(10): 6311-6317

17  Nocka KH, Levine BA, Ko JL, Burch PM, Landgraf BE, Segal R, Lobell R. Increased growth promoting but not mast cell degranulation potential of a covalent dimer of c-Kit ligand. Blood, 1997, 90(10): 3874-3883

18  Curtis BM, Williams DE, Broxmeyer HE, Dunn J,Farrah T, Jeffery E, Clevenger W et al. Enhanced hematopoietic activity of human granulocyte/macrophage colony-stimulating factor-interleukin 3 fusion protein. Proc Natl Acad Sci USA, 1991, 88(13): 5809-5813

19  Veiby OP, Jacobsen FW, Cui L, Lyman SD, Jacobsen SE. The flt3 ligand promotes the survival of primitive hemopoietic progenitor cells with myeloid as well as B lymphoid potential. Suppression of apoptosis and counteraction by TNF-alpha and TGF-beta. J Immunol, 1996, 157(7): 2953-2960

20  Muench MO, Roncarolo MG, Menon S, Xu Y, Kastelein R, Zurawski S, Hannum CH et al. FLK-2/FLT-3 ligand regulates the growth of early myeloid progenitors isolated from human fetal liver. Blood, 1995, 85(4): 963-972

21  Lisovsky M, Estrov Z, Zhang X, Consoli U, Sanchez-Williams G, Snell V, Munker R et al. Flt3 ligand stimulates proliferation and inhibits apoptosis of acute myeloid leukemia cells: Regulation of Bcl-2 and Bax. Blood, 1996, 88(10): 3987-3997


ReceivedFebruary 28, 2002    AcceptedJune 12, 2002

This work was supported by grants from IAEA Foundation (No.CRP/9/025) and the Nature Science Foundation of Jiangsu Province(No.BI98100 )

*Corresponding author: Tel, 86-512-5196902; Fax, 86-512-5194908;  e-mail, smbxuegz@public1.sz.js.cn