Http://www.abbs.info e-mail:abbs@sibs.ac.cn

ISSN 0582-9879                 ACTA BIOCHIMICA et BIOPHYSICA SINICA 2003, 35(9): 811-815                  CN 31-1300/Q

 

Involvement of Dopamine D3 and Neuropeptide Y Y5 Receptors in Diabetic Gastroparetic Rats without Response to Erythromycin

QIN Xin-Yu*#, WANG Zhi-Gang2#, FEI Jian3, LIU Feng-Lin, CUI Da-Fu3, CHEN Shao-Liang1

(Departments of General Surgery; 1Department of Nuclear Medicine, Zhongshan Hospital, Fudan University, Shanghai 200032, China; 2Surgical Department, Shanghai Jiaotong University Affiliated No.6 Hospital, Shanghai 200233, China3Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, the Chinese Academy of Sciences, Shanghai 200031, China)

 

Abstract        Erythromycin may accelerate gastric emptying in animals and human probably as an motilin agonist, but its prokinetic effects show obvious individual disparity. This study was to find the mechanism of this phenomenon. Microarray analysis was used to screen genes that might be involved in the response of diabetic gastroparesis rats to erythromycin. It was found that erythromycin accelerated gastric emptying of diabetic rats with great individual disparity. Through microarray analysis we screened differential expression genes that might be involved in the effect of erythromycin. Among 10 genes screened out, dopamine D3 receptor (DRD3) and neuropeptide Y Y5 receptor (NPYY5) genes were submitted to RT-PCR quantification and showed consistent results with microarray. It can be concluded that erythromycin promote gastric emptying of gastroparetic rats; DRD3 and NPYY5 may be involved in prokinetic action of erythromycin; and targets other than motilin receptor of erythromycin might exist as prokinetics..

 

Key words     diabetic gastroparesis erythromycin DNA microarray RT-PCR

 

Since erythromycin was observed to mimic motilin[1], it has attracted attention of many investigators because it has been found to improve delayed gastric emptying of diabetic patients with gastroparesis[2]. It was demonstrated that erythromycin and its derivatives were nonpeptide motilin agonists in rabbits and human[3,4]. Erythromycin has been used to treat kinds of digestive diseases with hypomotility including diabetic gastroparesis. During the clinical use of this prokinetics, however, we observed a quite different response varying from markedly effective to no effect at all. Our finding agrees with those of Tack's[5], who reported that a premature propagated phase III was elicited in only three of five patients with diabetic gastroparesis after intravenous administration of erythromycin. Little is known about the mechanism of the difference of effects.
The present study was to investigate the effect of erythromycin on gastric emptying of diabetic rats with gastroparesis, and screen genes with differential expression that might be involved in different effects of erythromycin from the aspect of pharmacogenetics.

 

1    Materials and Methods

1.1   Materials

70 male Sprague-Dawley rats were randomly selected from a large population, weighing 250330 g (mean 282 g). The rats were raised in three or four per cage in a temperature (25 ℃) and humidity (60%) controlled environment, with free food and water There is still no recognized standards of gastroparesis that stand for a series of symptoms due to delayed gastric emptying, so we set up our standards referring to literature with modification to study the effect of erythromycin on diabetic rats with delayed gastric emptying[6]. The standard used are as below (Fig.1): N, normal group; G, one hour retention (R1H) exceeded mean of N group by more than 60%; E, R1H reduced more than 30% by auto-control after administration of erythromycin; the remains were admitted to F group. S, negative control, using same volume of saline in stead of erythromycin.

 

Fig.1       The scheme for division groups of rats

 

1.2   Method

1.2.1       Measurement of liquid gastric emptying      The simultaneous gastric emptying of liquids was determined scintigraphically. After anaethesia by continual inhalation of ether, tested rat was placed supine beneath the detector immediately after infusing 2 ml Intralipid labeled with 100 μCi 99mT c-DTPA through gastric catheter. Simultaneous images were collected once per minute for one hour. I.v. injection of erythromycin (3 mg/kg) was given to test group while same volume of saline was used for negative control. Results were presented as R1H.

1.2.2       RNA extraction and microarray hybridization     Total RNA of rat antrum was prepared using TRizol reagent (Gibcol BRL). We chose a human receptor-related cDNA gene chip which contains 288 receptor-related genesCRs, Biostar Genechip Inc., Shanghai, China. 4 pairs of RNA samples randomly selected from E and F groups were submitted to microarray hybridization. Same amount of poly(A) RNA (24 μg) was labeled with Cy3 and Cy5-conjugated dCTP (Amersham Biosciences) by reverse transcription reaction and hybridized to human receptor-related gene chip (Cy3 for E group, Cy5 for F group)[7]. cDNA chips were scanned using Axon GenePix 4000B scanner (Axon Instruments). The relative fluorescence intensity was measured for each labeled RNA which was normalized by 40 house-keeping genes. Then the ratio of Cy5 to Cy3 was calculated. Cy5/Cy3 greater than 2 or less than 0.5 suggested significant changes in gene expression levels. Each RNA sample was labeled and hybridized twice to correct bias. Imagene 3.0 software was used to compile the overall list of consistently and significantly changed genes across the multiple hybridizations.

1.2.3       RT-PCR         Total RNA was treated with DNaseI (Gibco BRL), and converted to cDNA first strand by random hexamers using SuperscriptⅡ RNase H-RT kit (Gibco BRL). Among 10 genes with significant changes on expression, the two receptors of dopamine D3 and neuropeptide Y Y5 were performed by PCR amplification using house-keeping gene β-actin (βA) as internal control. RT-PCR was performed in 9 samples randomly from N group and all samples in E, F and S groups. Based on coding sequences, the following primers were used[810](Table 1).

 

Table 1   Sequence of primers used in RT-PCR

Genes

Sequence (5′→3)

PCR product (bp)

D3

AGACGTGTGGCACTCATGATC

CTTTGCCTCAGGACTATGTAGA

212

Y5

CCAGGCAAAAACCCCCAGCAC

GGCAGTGGATAAGGGCTCTCA

524

βA

ATCATGTTTGGGACCTTCAACA

CATCTCTTGCTCGAAGTCCA

318

 

50 μl final volume for PCR amplification contained same amount of cDNA, each pair of primers respectively, 2.5 u of Hotstar polymerase (Qiagen). In order to obtain maximal sensitivity, the number of cycles used for PCR with each primers pair was optimized according to the amplification curve obtained for every 5 cycles from 20 to 40 cycles. PCR was performed after predenaturation at 95 ℃(3 min) for 30 (D3), 28 (Y5) and 25 (βA ) cycles respectively, each cycle consisting of denaturation at 94 ℃ (1 min), annealing at 60 ℃ (1 min), extension at 72 ℃ (1 min). 10 μl of the RT-PCR products were electrophorezed on 2.0% agarose gels in 0.5×TAE buffer. To exclude the possibility of contamination of genomic DNA, RNA samples treated by RNase were subjected to PCR amplification without RT, and ddH2O was used as negative control.

Optimal density measurement of the lanes of the agarose gels was performed by means of a computer-assisted image analysis system. For each sample, a semiquantitative approach was used by comparing density value of each lane with that of βA in the same tissue sample. Data were presented as x±s. Paired t-test and ANOVA was used to evaluate the difference of the mean value (SPSS 11.0).

 

2    Results

2.1   Gastric emptying (GE)

According to the standard given above, among 55 test rats, 54 become diabetic rats, among which 29 become gastroparetic rats, 9 use saline injection (G group) for negative control (S group) and others use erythromycin. Gastric emptying of G group was slower than N group [R1H: (63.0%±6.8%) vs. (30.0%±4.5%), P0.01; but became faster after treatment of erythromycin [(36.0%±3.8%) vs. (42.0%±14.5%), P0.05. According to the effect of erythromycin gastroparetic rats were divided into E group (effective), F group (failure) and S group. The results are shown in Table 2. The difference of improvement (expressed in form of difference of R1H by self-comparison before and after treatment) between E and F group is statistically significant [(28.0%±7.5%) vs. (8.0%±5.2%), P0.01]. As a result, 11 showed prokinetic effect of erythromycin while 9 showed poor effect. R1H was used as an index to judge prokinetic effect of this drug. Fig.2 shows gastric emptying curves of G group rats.

 

Table 2   Effect of Erythromycin on R1H

group

Before treatment (%)

After treatment (%)

P

N

30±4.5

32±6.8

0.874

G

63±6.8

42±14.5

0.018*

E

64±6.5

36±3.8

0.001*

F

60±8.4

52±9.5

0.056

S

62±7.8

60±7.6

0.964

Data are expressed as x±s, *P0.05.

 

Fig.2       Gastric emptying curve of N and G group rats

 

2.2   Microarray hybridization and RT-PCR

cDNA microarray analysis revealed total of 10 genes with up-regulation or down-regulation (Table 3). Among these genes, it was found that dopamine D3 receptor gene and neuropeptide Y Y5 receptor gene may have some kinds of association with gastrointestinal motility regulation which will be discussed later. Microarray hybridization showed that expression of two genes were upregulated in E group than F group. So two genes were selected for further confirmation based on semiquantification of RT-PCR (Fig.3, Table 4).

 

Table 3   10 genes screened out with differential expression

Accession No.

Cy5/Cy3

Gene description

U70451

0.482

Myleoid differentiation primary response protein MyD88

D25278

0.092

mRNA for KIAA0036 gene, complete cds

D14689

0.443

mRNA for KIAA0023 gene, complete cds

NM-002360

0.293

Progesterone membrane binding protein (PMBP) mRNA

M22333

0.413

Factor VIII gene L1 element insertion DNA

U28811

0.445

Cysteine-rich fibroblast growth factor receptor (CFR-1) mRNA

AE000259

0.466

T-cell receptor alpha delta locus from bases 250472 to 501670

U25441

0.227

Dopamine D3 receptor (DRD3) gene, complete cds

NM-005123

0.422

Nuclear receptor subfamily 1NR1H4, mRNA

U94320

0.232

Neuropeptide Y5 receptor (NPYY5) mRNA, complete cds

 

Fig.3       Photograph of RT-PCR of D3 and Y5 receptor in antrum from four group rats

 

Table 4 RT-PCR results of D3 and Y5 receptors

Receptors

Cycles

E group

F group

N group

S group

D3

30

0.26±0.04

0.16±0.04

0.21±0.06

0.23±0.06

Y5

28

0.94±0.10

0.68±0.09

0.80±0.18

0.82±0.15

 

Semi-quantification analysis of expression of D3 and Y5 receptors in rat antrum. All Data are expressed as x±s of ratios between each receptor and β-actin in the same tissue sample. P value between E and F group for both D3 and Y5 are 0.001. There is no statistical difference in any other comparison between groups.

 

3    Discussion

With the development of pharmacogenomics, it has been known that efficacy of many drugs are due to different gene expression profiles coding their targets, transportor or enzymes.

Our findings are in accordance with those of previous studies that erythromycin has prokinetic effect on gastroparesis[11]. This is the first time to report effect of erythromycin on gastroparetic rats in vivo. It is consistent with in vitro study of Soulie et al.[12], in which he confirmed contractile effect of erythromycin on antral smooth muscle cells in STZ induced diabetic rats. We found that small dose (3 mg/kg) of erythromycin could markedly improve gastric emptying of diabetic rats with gastroparesis. The responses do have remarkable difference among diabetic rats. There is no effect on some rats while there is significant prokinetic effect on the others. These results prompted us to do further study on differential displaying of receptor-related genes that might be involved in the phenomina. D3 and Y5 receptors were significantly up-regulated in E group compared with F group. Theoretically, these 2 receptors may have some relations with gastro-intestinal motility referring to literature as below, and it is the reason we concentrate our interests on them, and we did not test other 8 genes yet.

Is D3 dopamine receptor involved in regulating gastric motility? No study has been focused on this issue until now. Recent study showed that dopamine D3 receptor in the area postrema plays an important role in the regulation of emesis. R(+)-7-OH-DPAT, a selective D3 receptor agonist, elicited nausea and vomiting in ferrets and dogs[13,14]. From a clinical point of view, dopamine receptor antagonist such as phenothiazine, butyrophenones and metoclopramide, which have affinity to D2 and D3 ,receptors are used as antiemetic agents. A study on the mechanism of gastroprokinetic effect of EM523, an erythromycin derivative, found that dopamine could suppress contactile activity induced by EM523 in dose-dependent manner. The mechanism through which receptor subtype dopamine exerted this effect is still unknown. Combined with our results, we hypothesize that dopamine inhibit gastrointestinal motility through D3 receptor, while erythromycin is antagonist of this receptor subtype. Rats with up-regulated dopamine D3 receptor expression show better response to erythromycin. The factor that induce up-regulation of these genes is still unknown. But we conclude that this is not an effect due to administration of erythromycin, because there is no difference between test groups(E and F group) and negative controls(S group).

Is NPY Y5 receptor related to gastrointestinal motility? Still no answer yet. Actually there are few reports concerning this question. NPY is a powerful stimulant of food intake and is proposed to activate a hypothalamic 'feeding' receptor, namely Y5 receptor. Some studies have confirmed that Y5 receptor is involved in food intake[15]. D-Trp(34)NPY, a potent and selective Y5 receptor agonist has dramatic effects on food intake, several selective Y5 antagonist, such as JCF 104, JCF109, CGP71683A, L-152 and 804, can all blockade NPY-induced feeding by Y5 receptor. One possibility is that erythromycin accelerates gastrointestinal motility as an agonist of Y5 receptor, so diabetic rats with up-regulated Y5 receptor expression have better response to erythromycin. Increased gastrointestinal motility also may explain more intensive food intake.
We can not identify the targets of erythromycin yet, but the results do suggest that there might be some kinds of connection between the prokinetic action of erythromycin and receptor other than motilin receptors, such as DRD3 and NPYY5 receptor. Theoritically, it is possible for a drug to have different targets under different conditions, and up- or down-regulation of the targets may be related to different response to a certain drug.

In fact, it is the first time to identify the presence of D3 DR and NPY Y5 receptors in stomach. We used human-receptor related gene to hybridize rat genes. From the view of homology of genes, we believe that the results have some important indications: the two receptors may be involved in the physiological regulations of gastro-intestinal activities such as motility.

Our hypothesis has quite limited foundations. We just aimed to find something involved in the mechanism underling the distinction of erythromycin's prokinetic effect. It is important to emphasize limitations of this study. A major one is that we used in vivo study during which differetial gene expression may be affected by many uncontrolled factors. The second is the unknown effect of erythromycin on the receptors under study. Despite these limitations, our results should encourage further research on this topic. Also, alternative explanations merits considerations for our results. The relationship between erythromycin and DR D3 and NPY Y5 receptors remains to be determined using multiple methods, for example, radio-labeled receptor binding study. Further study should be done to identify the roles of DR D3 and NPY Y5 receptor in stomach.
The conclusions of this study may be summarized as below: (1) Low dose (3 mg/kg) of erythromycin can markedly accelerate liquid gastric emptying of diabetic rats with gastroparesis. The responses are dramatically individual discrepancy. (2) Dopamine D3 receptor and neuropeptide Y5 receptor may be involved in prokinetic effect of erythromycin.

 

References

1     Itoh Z, Nakaya M, Suzuki T, Arai H, Wakabayashi K. Erythromycin mimics exogenous motilin in gastrointestinal contractile activity in the dog. Am J Physiol, 1984, 247(6 Pt 1): G688G694

2     Janssens J, Peeters TL, Vantrappen G, Tack J, Urbain JL, De Roo M, Muls E et al. Improvement of gastric emptying in diabetic gastroparesis by erythromycin. Preliminary studies. N Engl J Med, 1990, 322(15): 10281031

3     Peeters T, Matthijs G, Depoortere I, Cachet T, Hoogmartens J, Vantrappen G. Erythromycin is a motilin receptor agonist. Am J Physiol, 1989, 257(3 Pt 1): G470G474

4     Satoh M, Sakai T, Sano I, Fujikura K, Koyama H, Ohshima K, Itoh Z et al. An erythromycin derivative, is a potent motilin receptor agonist in human gastric antrum. J Pharmacol Exp Ther, 1994, 271(1): 574579

5     Tack J, Janssens J, Vantrappen G, Peeters T, Annese V, Depoortere I, Muls E et al. Effect of erythromycin on gastric motility in controls and in diabetic gastroparesis. Gastroenterology, 1992, 103: 7279.

6     Yamano M,.Kamato T, Nagakura Y Miyata K. Effects of gastroprokinetic agents on gastroparesis in streptozotocin-induced diabetic rats. Naunyn Schmiedebergs Arch Pharmacol, 1997, 356(1): 145150

7     Derisi JL, Iyer VR, Brown PO. Exploring the metabolic and genetic controls of gene expression on a genomic scale. Science 1997, 278: 680686

8     Caronti B, Calderaro C, Passarelli F, Palladini G, Pontieri FE. Dopamine receptor mRNAs in the rat lymphocytes. Life Sci 1998, 62(21): 19191925

9     Goumain M, Voisin T, Lorinet AM, Laburthe M. Identification and distribution of mRNA encoding the Y1, Y2, Y4, and Y5 receptors for peptides of the PP-fold family in the rat intestine and colon. Biochem Biophys Res Commun, 1998, 247(1): 5256

10    Takahashi N, Nagai Y, Ueno S, Saeki Y, Yanagihara T. Human peripheral blood lymphocytes express D5 dopamine receptor gene and transcribe the two pseudogenes. FEBS Lett, 1992, 314(1): 2325

11    Peeters TL. Erythromycin and other macrolides as prokinetic agents. Gastroenterology, 1993, 105(6): 18861899

12    Soulie ML, Cros G, Serrano JJ, Bali JP. Impairment of contractile response to carbachol and muscarinic receptor coupling in gastric antral smooth muscle cells isolated from diabetic streptozotocin-treated rats and db/db mice. Mol Cell Biochem, 1992, 109(2): 185188

13    Yoshikawa T, Yoshida N, Hosoki K. Involvement of dopamine D3 receptors in the area postrema in R(+)-7-OH-DPAT-induced emesis in the ferret. Eur J Pharmacol, 1996, 301(1-3): 143149.

14    Yoshida N, Yoshikawa T, Hosoki K. A dopamine D3 receptor agonist, 7-OH-DPAT, causes vomiting in the dog. Life Sci, 1995, 57(21): 347350

15    Lecklin A, Lundell I, Paananen L, Wikberg JE, Mannisto PT, Larhammar D. Receptor subtypes Y1 and Y5 mediate neuropeptide Y induced feeding in the guinea-pig. Br J Pharmacol, 2002, 135(8): 20292037


Received: March 18, 2003     Accepted: June 18, 2003

This work was supported by a grant from the National Natural Science Foundation of China (No. 30070738)

#These two authors contributed equally to this work

*Corresponding author: Tel, 86-21-64041990-2663; Fax, 86-21-64038472; e-mail, xyqin@zshospital.com