|
https://www.abbs.info e-mail: [email protected] ISSN |
Short Communication |
Isolation of a Multi-functional
Endogenous Cellulase Gene from Mollusc, Ampullaria crossean
WANG Ji, DING Ming, LI Yan-Hong, CHEN Qing-Xi, XU
Gen-Jun, ZHAO Fu-Kun*
( Key Laboratory of Proteomics, Institute of
Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, the
Chinese Academy of Sciences, Shanghai 200031, China )
Abstract The
cellulase genes of some animals, most coding for endo-β-1,4-glucanases, were
found and cloned. There has been no reports about genes encoding
exo-β-1,4-glucanase or endo-β-1,4-xylanase from animal. Here we cloned the cDNA
of a cellulase designated as EGX from mollusc, Ampullaria crossean, and
expressed it in Pichia pastoris for the first time. The cellulase EGX is a
multi-functional β cellulase with the activities of exo-β-1,4-glucanase,
endo-β-1,4-glucanase and endo-β-1,4-xylanase. The opening reading frame of EGX cDNA is 1185 bp and
encodes 395 amino acids. The EGX gene can also be amplificated from the genomic
DNA by PCR, which verified the endogenous origin of this gene. This EGX gene
was the first multi-functional cellulase gene that was directly isolated from
animals.
Key
words multi-functional
cellulase; EGX; gene isolation; Ampullaria crossean
Cellulose is one
of the most abundant renewable sources in the world. Many researches showed
that it had been technically feasible to obtain fermentable carbohydrate by the
enzymatic degradation of plant biomass for ethanol production[1]. The key
enzymes of this process are cellulases and xylanases. Cellulases include exo-β-1,4-glucanase
(E.C.3.2.9.11), endo-β-1,4-glucanase (E.C.3.2.1.4) and β-glucosidase
(E.C.3.2.1.21)[2]. Xylanases include endo-β-1,4-xylanase (E.C.3.2.1.8),
β-xylosidase (E.C.3.2.1.37) and some side-chain cleaving enzymes[3]. Till now,
cellulases and xylanases applied for practical purpose are mainly from
microorganisms, there are great needs to discover new cellulases and xylanases
with novel characteristics.
According to the
traditional view, animals do not produce cellulase themselves and live in
symbiosis with cellulytic microorganisms[4]. However, since the discovery of
endogenous endo-β-1,4-glucanase in termite[5] and nematode[6], this knowledge
should be corrected. By now, about 20 animal endo-β-1,4-glucanase and
β-glucosidase genes have been cloned, but there was no report about cloning of
exo-β-1,4-glucanase and xylanase gene from animal. Furthermore, among those
cloned cellulase genes, few have been successfully expressed[7,8], which
hindered the further study on animal cellulases.
Is the
endogenous cellulase system in animal incomplete? Does this animal cellulase
system include only endo-β-1,4-glucanase and β-glucosidase as plant cellulase
system? Could animal bodies degrade xylan? To explore above questions, we
purified an endogenous cellulase designated EGX from the mollusc, Ampullaria
crossean[9]. The cellulase EGX was characterized as a multi-functional
enzyme with the activity of exo-β-1,4-glucanase, endo-β-1,4-glucanase and
endo-β-1,4-xylanase[9].
In this paper, we report the cloning and
expression of the animal cellulase gene EGX. Our data demonstrates that
cellulase EGX is an endogenous cellulase and suggests that a complete cellulase
system might also exist in animals.
1 Materials and Methods
1.1 Materials
The mollusc, Ampullaria
crossean, were collected in
The thermal cycle was according to the Single BlockTM system (Ericomp Inc.,
Diego
The Multi-copy Pichia expression kit was purchased from Invitrogen (
Diego
1.2 Protein N-terminal sequencing
The stomach
juice was isolated from Ampullaria crossean to purify EGX[9].
The purified
tissue enzyme was subjected to SDS-PAGE and electroblotted on a polyvinylidene
fluoride membrane. Blotted protein bands were stained with Ponceau S and cut
out for protein sequencing. To obtain the internal sequence of EGX, the
purified EGX was digested by Endo Glu C protease (Promega,
The fragments were subjected to SDS-PAGE and electroblotted on a polyvinylidene
fluoride membrane. A band of about 31 kD was cut out for protein sequencing.
1.3 RNA isolation
Total RNA was
isolated from the stomach of the mollusc, Ampullaria crossean. The
stomach tissue, which was freshly cut, was dissected and homogenized in a
sterile glass homogenizer to isolate total RNA using Trizol (Life Technologies,
1.4 cDNA
synthesis and DNA amplification
The first strand
cDNA was primed with oligo(dT)12-18 on total RNA isolated from stomach tissue of Ampullaria
crossean. Amplification of the central region of EGX cDNA was performed
using the two degenerate primers, EGX01f and EGX01r (Table 1). To obtain the
3-terminal sequence of the gene, PCR was performed using the gene specific
primer EGX04f and oligo(dT)18. In the hemi-nested PCR, the gene specific primer
EGX03f and oligo(dT)18 were employed. Amplification of the 5-terminal sequence
was performed according to the protocol of the 5′ RACE system for rapid amplification of cDNA ends version 2.0 (Life
Technologies, Cergy Pontoise, France). The first strand cDNA was primed with
the primer EGX05f. The first PCR was performed with the gene specific primer
EGX06f and the anchor primer. Then, in the nested PCR, the gene specific primer
EGX07f and the universal amplification primer (UAP) were employed. To obtain
the opening reading frame, a 1.3 kb DNA fragment was amplified with the primer
EGX10f and EGX10r. The 1.3 kb DNA fragment was cloned and sequenced. Plasmids
from six clones were sequenced to avoid possible errors caused by DNA
amplification.
1.5 Genomic DNA PCR amplification
Genomic DNA was
isolated from ovary tissue of Ampullaria crossean using the 3S Spin
cell/tissue genomic DNA isolation kit (Shenergy Biocolor Biological Science
& Technology Company,
The TaKaRa Ex Taq (TaKaRa,
was employed in DNA amplification. PCR amplification was carried out on 45 μg
of Ampullaria crossean genomic DNA template using the cDNA specific
primer EGX11f (containing the start codon) and EGX11r (just before the stop
codon) (Table 1). The PCR was performed with an annealing temperature of 62 ℃ for 30 cycles. The resulted PCR
product was cloned and sequenced.
1.6 Recombinant
expression of EGX in Pichia pastoris
The opening
reading frame of EGX was amplified with the primer Wt-11f and Wt-10r. After
digested with EcoRI and NotI, the fragment was ligated into the P. pastoris
expression vector pPIC9K (Invitrogen, De schlep,
The P. pastoris EGX expression clone was constructed according to the Pichia
User Manual (Invitrogen, De schlep,
P. pastoris GS115 strain was selected to be used as a host strain and the
restriction enzyme Bpu1102I was chosen to linearize the constructed vector
before being tranformed to the host cell. A P. pastoris GS115 control clone
transformed with the Bpu1102I-linearized pPIC9K plasmid was also constructed.
To detect the endo-β-1,4-xylanase activity
of expressed EGX, the EGX expression clone and the control clone were dotted on
a the BMMY plate containing 1 g/L xylan from birchwood, 20 mmol/L NaCl, 100
mmol/L phosphate buffer, pH 5.8. After a 6-day culture in 29 ℃, the plate was stained with 1 g/L
Congo red and destained with 1 mol/L NaCl to visualize the hydrolysed zone[10].
To detect the
endo-β-1,4-glucanase activity, the P. pastoris expression clone and the control
clone were cultured and induced in the liquid medium according to the Pichia
User Manual (Invitrogen, De schlep, Netherlands) except the BMGY and BMMY
contain 20 mmol/L NaCl and were buffered with 100 mmol/L phosphate buffer, pH
6.0. After a 6-day induction at 28 ℃, the culture supernatants were collected for activity assay. The
culture supernatants were added on agarose plate containing 0.2 g/L
carboxylmethyl cellulose sodium (CMC-Na), 100 mmol/L NaCl and 100 mmol/L
acetate buffer, pH 5.2. After incubation in 30 ℃ for 48 h, the endo-β-1,4-glucanase activity on the plate was
visualized by being stained with 1 g/L Congo red and destained with 1 mol/L
NaCl[10].
The detection of
exo-β-1,4-glucanase activity was similar with endo-β-1,4-glucanase activity
except that 0.2 g/L carboxylmethyl cellulose sodium (CMC-Na) was substituted by
4.32 mmol/L p-nitrophenyl cellobioside (pNPC) and 5.61 mmol/L D-gluconic acid
lactone and 2% Na2CO3 was added to visualized the activity[11].
2 Results and Discussion
2.1 cDNA sequence
The N-terminal
and internal sequences of EGX were determined to isolate cDNA of EGX (Table 1).
The sequence of EGX cDNA reveals an opening
reading frame of 1185 bp(Fig.1). The putative ATG start codon is found to be at
162 bp from the 5′ end of the
cDNA. The 3′ untranslated
region contains a putative polyadenylation signal (AATAAA), 24 nucleotides
upstream from the poly(A) tail, suggesting that the 3′ untranslated region was complete.
Table 1 Partial amino acid sequences of purified
EGX and oligonucleotide primers used to synthesizing the first strand cDNA
synthesis, PCR amplification and EGX cloning
|
Protein/Primer |
Sequence |
|
EGX(N-terminal) |
AAGAGVTSEI |
|
EGX(internal) |
LFRIAHAADP |
|
EGX01fa |
GC(A/T/G/C)GC(A/T/G/C)GG(A/T/G/C)GC(A/T/G/C)GG(A/T/G/C)GT(A/T/G/C)AC |
|
EGX01ra |
GG(A/G)TC(A/T/G/C)GC(A/T/G/C)GC(A/G) |
|
EGX03f |
ATGACAATGGCTACAAC |
|
EGX04f |
ACCAGCATCAACTGAATG |
|
EGX05f |
ACATCCCAGTGCT |
|
EGX06f |
GAGCCTTGACCCAGTTCTG |
|
Anchor |
GGCCTGCAGTCGACTAGTAC-oligo(dT)17 |
|
EGX07f |
ACCGCCCAGTTGTAGTGCTGGT |
|
UAP |
GGCCTGCAGTCGACTAGTAC |
|
EGX10f |
CAGGCTGACCAGAATCCACTA |
|
EGX10r |
TTCAACTTTATTGCCCTCTG |
|
EGX11f |
ATGCCCTCTGGTGCTGCTG |
|
EGX11r |
AATGTTGACGGTGTGGGGAC |
|
Wt-11f |
TAAGAATTCCCCTCTGGTGCTGCTGGT |
|
Wt-10r |
GTAGCGGCCGCGCTCTAGCTAACATTAATG |
a Degenerative
primers derived from the N-terminal and the internal amino acid sequence of
EGX.
The opening reading
frame is conceptually translated into 395 amino acids. The N-terminus of the
purified EGX starts at nucleotide 13. There are only four amino acids absent in
the N-terminus of the purified EGX. After being deleted the four amino acids,
the calculated molecular weight of EGX is 44.12 kD, which is similar to the
apparent molecular weight of 41.5 kD of the purified EGX as estimated by
SDS-PAGE[9]. On the other hand, the software of SignalP V2.0 failed to predict
the potential signal peptide cleavage site in the N-terminal sequence of EGX.
There is no evidence for a typical N-terminal signal peptide in the putative
amino acid sequence. Similar to EGX, it has also been reported the
endoglucanase CelC from anaerobic bacterium Clostridium thermocellum does not
display a signal peptide but could be secreted to the growth medium with an
unknown mechanism[12]. The mechanism of EGX secretion in animal cell remains to
be further identified.
Many fungal
cellulases with hydrolytic activity to crystalline cellulose substrates, such
as Sigma cell type 101, consist of not only catalytic domains, but also
cellulose binding domains and Pro/Thr/Ser-rich sequence linkers hinging
catalytic domains and cellulose binding domains[13]. The putative amino acid
sequence of EGX does not contain Pro/Thr/Ser-richsequence. In addition, as
analyzed with the Conserved domain database search, EGX does not show
meaningful similarity towards any type of cellulose binding domain. Thus, it is
considered that EGX does not contain a structurally well defined cellulose
binding domain, which is similar to the single domain endoglucanase NtEG from
termite, Nasutitermes takasagoensis[14].
