https://www.abbs.info
e-mail: [email protected]
ISSN
0582-9879 Acta Biochim et Biophysica Sinica 2004, 36(1):51-57 CN 31-1300/Q
Analysis of Five Differentially Expressed Gene Families
in Fast Elongating Cotton Fiber
Jian-Xun FENG, Sheng-Jian JI, Yong-Hui SHI, Yu XU, Gang
WEI, and Yu-Xian ZHU*
( National Laboratory of Protein Engineering and Plant Genetic
Engineering, College of Life Sciences, Peking University, Beijing
100871, China )
Abstract Using the suppression subtractive hybridization
method, we isolated five gene families, including proline-rich proteins (PRPs),
arabinogalactan proteins (AGPs), expansins, tubulins and lipid transfer
proteins (LTPs), from fast elongating cotton fiber cells. Expression profile analysis
using cDNA array technology showed that most of these gene families were highly
expressed during early cotton fiber developmental stages (0–20 day post
anthesis, DPA). Many transcripts accumulated over 50-fold in 10 DPA fiber cells
than in 0 DPA samples. The entire gene family ―AGP, together with 20 individual members in other 4 gene families, are
reported in cotton for the first time. Accumulation of cell wall proteins, wall
loosening enzymes, microtubules and lipid transfer protein may contribute directly
to the elongation and development of fiber cells.
Key words cotton fiber; cDNA array; cell elongation;
arabinogalactan protein; lipid transfer protein
Cotton fibers are long (30–40 mm) and thin (15 μm) unicellular
structures that emerge from certain epidermal cells in the outer integuments of
cotton ovules. Fiber development can be conceptually separated into four
phases: initiation, elongation, secondary wall deposition and maturation [1].
Usually fibers initiate at or just before anthesis and soon enter a rapid
elongation period that lasts until 25 d post anthesis (DPA). Fiber cells
display the most rapid elongating rate around 10 DPA. During secondary wall
deposition stage (20–45 DPA), fibers undergo mainly cellulose biosynthesis,
which results in very high cellulose content (about 90%) in these cells. In the
past decade, great efforts have been made to elucidate molecular mechanisms of
cotton fiber development, many cotton genes have been isolated, and even
transgenic cottons have been obtained [2,3]. However, no single crucial fiber
factor has been discovered, which suggests that regulation of fiber development
may require a number of genes [4].
Proline-rich proteins (PRPs) and arabinogalactan proteins
(AGPs) are two important cell wall structural proteins[5,6]. PRPs are widely
distributed in plants and are encoded by gene families. PRP members showed to
be regulated both temporally and spatially during plant development [7]. In
cotton, several different PRP genes were isolated and analyzed [8,9]. AGPs are
a family of proteoglycans that have been implicated in various aspects of
cellular activities [10,11]. Expansin(EXP), encoded by a highly conserved
multigene family, mediate pH-dependent extension of plant cells by disrupting
hydrogen bonds at the interfaces between individual cell wall polymers
[6,12,13]. Expansins appear to be involved in a variety of plant processes,
such as cell growth and polarity, root hair formation and growth, organogenesis
and fruit ripening [14]. Several expansin genes were reported from cotton fiber
[15,16]. Microtubules play central roles in many important cellular processes
in higher plants [17]. Microtubules consist mainly of α-tubulin (ATub) and β-tubulin (BTub), both of
which are encoded by multigene families in plants [2]. In cotton, nine α-tubulin and seven β-tubulin isotypes were
identified using two-dimensional gels, and the expression
of α-tubulin
genes were studied in fiber cells [18,19].However, only two β-tubulin genes were
isolated and characterized so far [2,20].
Lipid transfer proteins (LTPs) are small cysteine-rich
lipid-binding proteins and are also called non-specific LTPs (nsLTPs) since
they transfer membrane lipids with no specificity. In plants, LTPs are probably
involved in somatic embryogenesis, in defence against pathogens, and in the
formation and reinforcement of waxy cuticle layers in plant surface [21,22].
Several plant LTPs have been identified in cotton fibers [21,23,24]. Despite
recent progress in cotton gene isolation, there is no report concerning the
expression patterns of gene families as a whole.
In this work, five gene families that are preferential to
cotton fiber were identified from a subtractive cDNA library, and their RNA
levels during the early cotton fiber development stages were studied .
Materials and Methods
Plant materials
Upland cotton and its fuzzless-lintless mutant (fl)
were field grown during the summer of 2001. The mutant was originally
discovered in an upland cotton (Gossypium hirsutum L. cv. Xuzhou 142) field
in China [25]. Immediately after harvest, developing ovules were excised from
each boll and fiber cells were carefully scraped from the epidermis of the
ovules. All harvested plant materials were frozen in liquid nitrogen and stored
at –80 ℃ before use.
cDNA array preparations
Suppression subtractive hybridization was carried out
using cDNAs prepared from 10 DPA cotton fiber and fl mutant ovule as
tester and driver, respectively. The subtracted cDNAs were inserted directly
into the T/A cloning vector to transform E. coli DH5α cells, which
produced the resultant subtractive cDNA library[4]. The clones with different
gene families were selected from the subtractive library and cultured in 200 μl of LB-Amp medium in
96- well plates at 37 ℃. The cDNA
inserts were amplified by PCR in a 96-well PTC200 peltier thermal cycler (MJ
Research, USA) following the procedure described previously [4]. All PCR
products were analyzed by agarose gel electrophoresis and quantified using a
spectrophotometer. Then DNA (0.3 μg) samples were printed from PCR plates onto the nylon
membranes (Roche, Germany) using the Biomek2000 laboratory automation
workstation (Beckman Coulter, USA). The cotton ubiquitin was also printed onto
each membrane as the internal controls. Distilled water, PCR primers and vector
DNA were used as the negative controls.
Hybridization of cDNA arrays, image acquisition and
analysis
RNA isolated from 0, 5, 10 and 20 DPA cotton fibers were
used to prepare probes for expression pattern analysis. Images were acquired by
scanning the membranes with a Typhoon 9210 scanner (Molecular Dynamics, USA).
Data analysis was performed using ArrayVision 6.0 software (Imaging Research,
USA). The radioactive intensity of each spot was quantified as volume values
and the levels of the local background were subtracted to obtain the subtracted
volume values designated as sVOL. Ubiquitin cDNA was used as the internal
control, its subtracted volume value was termed as sRef. Normalization among
all images was performed by dividing sVOL of each spot by the sRef value in the
same image, resulting in a normalized volume value (nVOL) for each spot. nVOL
values were comparable among all obtained images. The nVOL values of each gene
at 5, 10 and 20 DPA were divided by that at 0 DPA to obtain the fold of
increase in the gene expression level.
Semi-quantitative RT-PCR
Total RNA was isolated from wild type cotton fibers.
First-strand cDNA was synthesized from 5 μg total RNA using SUPERSCRIPT first-strand synthesis
system for RTPCR (Gibco, New York, USA). One tenth of the synthesized
first-strand cDNA was used as templates in 50-μL PCR with gene-specific RT-PCR primers designed
according to the cDNA sequence and synthesized commercially (TaKaRa, Dalian,
China). Parallel reactions using cotton ubiquitin primers served to normalize
the amount of template added. According to the transcription level of these
family genes, some clones were chosen to verify the result of microarray by
RT-PCR. All RT-PCR primers used in this study are listed in Table1.
Table 1 The sequence
and characterization of RT-PCR primers
|
|
Primer sequences |
Tmperature of annealing |
Cycles |
|
PRP2 |
Sense : ATTGTTCATTGTTGCTACAAATG |
55 ℃ |
25 |
|
Antisense: GAGCAACTGGTCTCTCTTCAAAC |
|||
|
PRP4 |
Sense : GGATGGGCTCTGCTCAATCTG |
53 ℃ |
25 |
|
Antisense: CAAAAGGTAAAAAAATAATAATGTC |
|||
|
LTP6 |
Sense : GCATGTCTGTTGGTGTTGTGC |
59 ℃ |
25 |
|
Antisense: ATCCAATGTAGCAAGCAAGCC |
|||
|
LTP10 |
Sense : AAAGCCCCCACCCTGGATTGT |
60 ℃ |
25 |
|
Antisense: ATGGATATAACAAACATAGCCGCA |
|||
|
BTub8 |
Sense : GGCAAGTTTTGGGAAGTAGTATGT |
52 ℃ |
25 |
|
Antisense: TCCCTTAGCCCAGTTATTGCC |
|||
|
BTub9 |
Sense : GGGGAAGGAATGGATGAAATG |
60 ℃ |
25 |
|
Antisense: ACCAAGTAGTCCCCAAAAACACC |
|||
|
EXP2 |
Sense : TTCAAGGGTATGGAACGAGCA |
57 ℃ |
25 |
|
Antisense: GATGCCTCCTTTCTTCACACA |
|||
|
EXP4 |
Sense : TCAGTGTCCATCAAGGGTTCC |
58 ℃ |
25 |
|
Antisense: GCACTTGCTCGCCTATTTCAC |
|||
|
Ubiquitin |
Sense : AAGACCTACACCAAGCCCAAGA |
60 ℃ |
25 |
|
Antisense: CTCTTTCCTCAGCCTCTGAACCT |
Results
Isolation of five gene families
From a pool of subtractive cDNA fragments that were
either expressed only in cotton fiber or displayed in significantly higher
levels (>2-fold) in fibers compared to mutant
ovules, five large gene families, including PRPs, AGPs,
expansins, tubulins and LTPs were identified. PRPs, expansins, tubulins and
LTPs showed high sequence identities
with their homologs reported previously in cotton fiber
and other plants (data not shown). AGPs shared 58%–59% identities in the deduced amino acid level (data not shown). Among
the 32 independent cDNAs (6 PRPs, 5 AGPs, 4 expansins, 6 tubulins, 11 LTPs)
belonging to these families, 20 are potential new members. Because no AGP gene
families have been reported in cotton previously, all sequences of these cDNAs
are deposited in the EST division of GenBank with accession numbers from
CB350396 to CB350561 and can be accessed individually from the supplementary
material of Ji et al. [4].
Expression analyses by cDNA array
We studied the expression patterns of these gene families
during early cotton fiber development. The printed cDNA arrays were hybridized
to [33P]-labeled
probes prepared from 0, 5, 10 and 20 DPA wild-type cotton RNA,respectively (Fig.
1). Most cDNAs showed very low expression levels in 0 DPA cotton fiber and were
usually activated after 5 DPA. A major portion of these cDNAs reached peak
levels around 10 DPA with decreases observed thereafter, which indicated their
potential importance in the fiber elongation phase. The semi-quantitative
RT-PCR result shown in Fig. 2 was almost similar to the microarray result of
these gene families. So the result of microarray is reliable.
