Original Paper |
|
|||
|
Acta Biochim Biophys |
||||
|
doi:10.1111/j.1745-7270.2006.00198.x |
B22 Glu Des-B30 Insulin: A
Novel Monomeric Insulin
Hai-Juan DU1,3,
Jia-Hao SHI1, Da-Fu CUI1,
and You-Shang ZHANG1,2*
1
Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological
Sciences, Chinese Academy of Sciences, Shanghai 200031, China;
2 Institute of Protein Research, Tongji
University, Shanghai 200092, China;
3
Graduate School of the Chinese Academy of Sciences, Shanghai 200031, China
Received: March 10,
2006
Accepted: May 16,
2006
*Corresponding
author: Tel, 86-21-54921237; E-mail, yszhang @sibs.ac.cn
Abstract Studies on monomeric insulin with reduced self-association
are important in the development of insulin pharmaceutical preparations with
rapid hypoglycemic action on patients with diabetes. Here we report a novel
monomeric insulin, B22 Glu des-B30 insulin, prepared from a single chain
insulin precursor with B22 Arg mutated to Glu, which was expressed in Pichia
pastoris and converted to B22 Glu des-B30 insulin by tryptic digestion. It
still retains 50% of the in vivo biological activity of porcine insulin
and does not form a dimer even at a concentration of 10 mg/ml, showing that B22
Glu plays a key role in reducing the self-association of the insulin molecule
without greatly reducing its biological activity. This novel monomeric insulin
might have potential applications in the clinic.
Key words monomeric insulin; B22 Glu des-B30 insulin;
self-association
Insulin is a globular protein composed of two polypeptide chains
and three disulfide bonds [1]. In the pancreatic islet cells, insulin is
stored as Zn-insulin hexamers. In the bloodstream, insulin is highly diluted
and dissociates rapidly into monomers, which bind to the insulin receptor [2].
In insulin preparations of therapeutic concentration, insulin exists as dimers
and hexamers [3]. After insulin injection, there is a delay in insulin
absorption with an initial lag phase followed by dissociation of insulin
oligomers with a gradual increase in absorption rate [4]. Therefore, monomeric
insulin with reduced self-association has the benefit of rapid action in
treating patients with diabetes.
Porcupine insulin and guinea pig insulin have unusual low potency
and low self-association. It was suggested that the residue B22 Asp might be
responsible for these unusual properties [5,6]. However, when B22 Arg of
porcine insulin was replaced by Asp, the product still retained 50% of the in
vivo insulin activity as shown by our previous studies [7,8]. Hence, it is
worth studying whether the replacement of B22 Arg by Glu will affect its
self-association behavior. It is well known that the removal of B30 residue by
tryptic digestion has no effect on the potency, conformation or
self-association of insulin. Here, we report the preparation and
characterization of B22 Glu des-B30 insulin. It was found that B22 Glu des-B30
insulin possessed 50% of the in vivo biological activity of porcine
insulin and did not self-associate under our experimental conditions of neutral
pH and high concentration.
Materials and Methods
Construction of Pichia
pastoris expressing B22 Glu insulin precursor
The B22 Arg codon AGA of the single chain insulin precursor gene in
plasmid pPIC9K/PIP, constructed in our laboratory for secretory expression of
single chain insulin precursor [9], was mutated to Glu codon GAA by PCR method.
Two overlapped double-stranded DNA fragments containing the mutated B22 codon
were made separately using pPIC9K/PIP as the template and the following pairs
of nucleotides as the primers: TTCGAAGGATCCATGAGA/AGAAACCTTCTTCACCGCA; and
GGTTTGCGGTGAAGAAGGTT/GGCAAATGGCATTCTGACATC. Using these DNA fragments as the
template and TTCGAAGGATCCATGAGA/GGCAAATGGCATTCTGACATC as the primers, the full
length of DNA containing the mutated gene was made, which was cleaved by BamHI/EcoRI
digestion and cloned into pPIC9K to obtain plasmid pPIC9K/EPIP. The mutated
gene was confirmed by DNA sequencing. The plasmid pPIC9K/EPIP was linearized by
BglII digestion and cloned into P. pastoris GS115 by
electroporation. Transformant with a high copy number of mutated gene
integrated into the chromosome was selected [10]. The expression of B22 Glu
insulin precursor was detected by pH 8.3 native PAGE.
Secretory expression and
purification of B22 Glu insulin precursor
A strain of phenotype GS115 (His+Mut+) was
cultured in a 16 liter fermentor as described by Wang et al. [9]. After
centrifugation (6430 g for 20 min) of the culture, the supernatant was
applied to an XAD-7 column and washed with 5% acetic acid to remove impurities.
The expression product was eluted from the column with 45% ethanol/5% acetic
acid. The eluent was concentrated in a rotating evaporator and freeze-dried. The
lyophilized powder was dissolved in 1 M acetic acid and the expressed
precursor was precipitated with trichloroacetic acid, followed by gel
filtration using a Sephadex G-25 column. The product was further purified with HPLC using a C18
column (4.6 mm250 mm; Beckman) under the following conditions: solvent A (0.1% trifluoroacetic acid); solvent B (70% acetonitrile
containing 0.08% trifluoroacetic acid); elution gradient 35%–50% of solvent B
in 30 min; flow rate, 2 ml/min; and wavelength, 280 nm.
Conversion of the precursor
into B22 Glu des-B30 insulin
The purified precursor at a concentration of 10 mg/ml was converted
to B22 Glu des-B30 by tryptic digestion in 0.1 M ammonium bicarbonate at 4 ºC
overnight, the ratio of substrate to enzyme being 200:1 (W/W).
The product purified by HPLC was homogeneous in native pH 8.3 PAGE.
Bioassay of B22 Glu des-B30
insulin
The in vivo biological activity was measured by mouse
convulsion assay and rabbit blood glucose lowering assay in the Chinese
Pharmacopoeia 1985.
Circular dichroism analysis
Samples (3.5´10-5 M) in pH 7.4 Gomori buffer were measured in a Jasco-715
spectropolarimeter at room temperature. The far-UV spectra were scanned from
250 to 190 nm in a cell of 0.1 cm path length and the near-UV spectra scanned
from 300 to 245 nm in a cell of 1.0 cm path length.
Determination of
self-association by size exclusion chromatography
The experiment was carried out as reported previously [11] under the
following conditions: Superdex 75 column (HR 10/30); 0.1 M ammonium bicarbonate
buffer, pH 7.8 or phosphate-buffered saline, pH 7.4; flow rate 0.4 ml/min; room
temperature; and detection at 230 nm. All the samples were zinc free. For
molecular weight estimation, the distribution coefficient was calculated according to the following Equation 1:
Eq. 1
where Vr is the retention volume, V0 the void volume, and Vc the
total bed volume. Molecular weight was estimated from KD vs. logarithmic molecular weight plot.
Results
Conversion of the purified
precursor into B22 Glu des-B30 insulin
The purified precursor was cleaved by trypsin and purified by HPLC.
The final product was a single band in native pH 8.3 PAGE (Fig. 1). The
molecular mass (5677.8) determined with an ABI API2000 Q-trap mass spectroscope
was consistent with the theoretical value.
Biological activity
The in vivo biological activity of B22 Glu des-B30 insulin
determined by mouse convulsion assay (Table 1) and rabbit blood glucose
lowering assay (Fig. 2) was approximately 50% of porcine insulin
activity.
Circular dichroism analysis
The far-UV spectrum of B22 Glu des-B30 insulin showed distinct
differences from that of des-B30 insulin (Fig. 3). The negative
ellipticity at 222 nm decreased and almost disappeared, and that at 208 nm
increased. The ellipticity at 200 nm also reduced and there was a blue-shift
between 210 and 200 nm. These results indicate that B22 Glu des-B30 insulin has
a lower a-helix content and looser conformation, consistent with a previous
report [12] that monomeric insulin had less negative ellipticity at 222 nm and
more negative ellipticity at 208 nm. The near-UV spectrum of B22 Glu des-B30
insulin also changed remarkably. There was no obvious negative peak and the
negative ellipticity at 275 nm reduced. It was known that the dissociation of
insulin oligomer into monomer was reflected by a weakening of the negative peak
at 275 nm arising from B16 and B26 tyrosines at the monomer-monomer interface
[13–16].
Self-association studied by
size exclusion chromatography
Fig. 4 and Table 2 show the size
exclusion chromatography profiles of B22 Glu des-B30 insulin and porcine
insulin. The apparent molecular weight of B22 Glu des-B30 insulin estimated by
the KD vs. molecular weight plot was found to be 6025, corresponding to
the theoretical value 5768 of the monomer (Fig. 5). In contrast to
porcine insulin, the peak was symmetrical and the retention volume was
concentration-independent.
Discussion
Here we report the expression and characterization of monomeric B22
Glu des-B30 insulin. It has 50% of the in vivo biological activity of
porcine insulin, similar to that of B22 Asp insulin reported
earlier in our laboratory [7,8]. The mutation of B22 Arg with positive charge
to Asp with negative charge has such remarkable effect that B22 Glu des-B30
insulin exists as a monomer in solution of neutral pH and high concentration.
We would expect B22 Asp insulin is also monomeric, although this was not
studied in our earlier work. The mutation of Arg to Glu has the advantage that
the peptide bond after B22 will not be cleaved by trypsin. Therefore, the
expressed single chain precursor can be converted easily to B22 Glu des-B30
insulin by tryptic digestion, which is much more efficient than tryptic
transpeptidation to obtain wild-type insulin. In addition, the deletion of B30
by tryptic digestion was known to have little effect on insulin conformation
and activity. X-ray structural analysis [17,18] showed that B22 Arg was in the
B20–B23
b-turn
and the B24–B26 intermolecular anti-parallel b-sheet was important for
dimer formation. The conformation of the b-turn and b-sheet might be
destroyed by the mutation of B22 Arg to Glu as shown by circular dichroism
studies. Using the methods of Yang et al. [19] and Chang et al.
[20], the a-helix content was found to decrease by approximately 10%, whereas
the b-sheet content increased by approximately 14% compared with des-B30
insulin.
In conclusion, the present study demonstrates that B22 Glu des-B30
insulin is a novel monomeric insulin with 50% of the in vivo biological
activity of porcine insulin. It might have potential applications in the
clinic.
Acknowledgement
We are grateful to Ms. Xiao-Xia SHAO of Tongji University (Shanghai,
China) for determining the molecular weight by mass spectroscopy.
References
1 Cahill GF Jr. The Banting Memorial Lecture
1971. Physiology of insulin in man. Diabetes 1971, 20: 785–799
2 Blundell TL, Dodson GG, Hodgkin DC, Mercola
D. Insulin: The structure in the crystal and its reflection in chemistry and
biology. Adv Protein Chem 1972, 26: 279–402
3 Kjeldsen T, Pettersson AF. Relationship
between self-association of insulin and its secretion efficiency in yeast.
Protein Expr Purif 2003, 27: 331–337
4 Binder C. Absorption of injected insulin. A
clinical-pharmacological study. Acta Pharmacol Toxicol 1969, 2: 1–84
5 Horuk R, Blundell TL, Lazarus NR, Neville RW,
Stone D, Wollmer A. A monomeric insulin from the porcupine (Hystrix cristata),
an Old World hystricomorph. Nature 1980, 286: 822–824
6 Zimmerman AE, Yip CC. Guinea pig insulin I.
Purification and physical properties. J Biol Chem 1974, 249: 4021–4025
7 Zhu SQ, Li TF, Cui DF, Cao QP, Zhang YS.
Effect of B22-arginine replacement on the biological activity of insulin. Sci
Sin 1981, 24: 264–271
8 Fan JH, Tang YH, Feng YM, Zhang YS. Enzymatic
synthesis of [B22Asp] despentapeptide insulin with chymotrypsin. Acta Biochim
Biophys Sin 1992, 24: 7–13.
9 Wang Y, Liang ZH, Zhang YS, Yao SY, Xu YG,
Tang YH, Zhu SQ et al. Human insulin from a precursor overexpressed in
the methylotrophic yeast Pichia pastoris and a simple procedure for
purifying the expression product. Biotechnol Bioeng 2001, 73: 74-79
10 Invitrogen. Pichia Expression Kit,
Protein Expression, A Manual of Methods for Expression of Recombinant Proteins
in Pichia pastoris. Catalog No. K1710-01. 2005, http://www.invitrogen.com
11 Ding JG, Fei J, Cui DF, Zhang YS. Expression
of monomeric insulin precursor in Pichia pastoris and its
conversion into monomeric B27 Lys destripeptide insulin by tryptic hydrolysis.
Acta Biochim Biophys Sin 2005, 37: 234–240
12 Melberg SG, Johnson WC. Changes in secondary
structure follow the dissociation of human insulin hexamers: A circular
dichroism study. Proteins 1990, 8: 280–286
13 Morris JW, Mercola D, Arquilla ER. An analysis
of the near ultraviolet circular dichroism of insulin. Biochim Biophys Acta
1968, 160: 145–150
14 Goldman J, Carpenter FH. Zinc binding,
circular dichroism, and equilibrium sedimentation studies on insulin (bovine)
and several of its derivatives. Biochemistry 1974, 13: 4566–4574
15 Wood SP, Blundell TL, Wollmer A, Lazarus NR,
Neville RW. The relation of conformation and association of insulin to receptor
binding; x-ray and circular-dichroism studies on bovine and hystricomorph
insulins. Eur J Biochem 1975, 55: 531–542
16 Strickland EH, Mercola D. Near-ultraviolet
tyrosyl circular dichroism of pig insulin monomers, dimers and hexamers.
Dipole-dipole coupling calculations in the monopole approximation.
Biochemistry 1976, 15: 3875–3884
17 Baker EN, Blundell TL, Cutfield JF, Cutfield
SM, Dodson EJ, Dodson GG, Hodgkin DM et al. The structure of 2 Zn pig
insulin crystals at 1.5 Å resolution. Philos Trans R Soc Lond B Biol Sci 1988,
319: 369–465
18 Peking Insulin Structure Research Group.
Studies on the insulin crystal structure: The molecule at 1.8 Å resolution. Sci
Sin 1974, 17: 752–778
19 Yang JT, Wu CS, Martinez HM. Calculation of
protein conformation from circular dichroism. Methods Enzymol 1986, 130: 208-269
20 Chang CT, Wu CS, Yang JT. Circular dichroic
analysis of protein conformation: Inclusion of the b-turns. Anal
Biochem 1978, 91: 13–31