Categories
Articles

ABBS 2005,38(08): Optimized Adaptor Polymerase Chain Reaction-based Method for Efficient Genomic Walking


Original Paper

Pdf
file on Synergy
OPEN

omments

Acta Biochim Biophys
Sin 2006, 38: 571-576

doi:10.1111/j.1745-7270.2006.00194.x

optimized adaptor
polymerase
chain reaction-based method
for efficient genomic walking

Peng XU1,2,
Rui-Ying HU
1,2, and Xiao-Yan DING1*

1
Laboratory of Molecular and Cell Biology and Laboratory of Stem Cell Biology, Institute
of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences,
Chinese Academy of Sciences, Shanghai 200031, China;

2
Graduate School of the Chinese Academy of Sciences, Shanghai 200031, China

Received: March 20,
2006

Accepted: April 29,
2006

This work was
supported by a grant from the National Key Project for Basic Science Research
of China (2001CB509901)

*Corresponding
author: Tel, 86-21-54921411; Fax, 86-21-54921011; E-mail,
[email protected]

Abstract        Genomic walking is one of the most useful approaches in
genome-related research. Three kinds of PCR-based methods are available for
this purpose. However, none of them has been generally applied because they are
either insensitive or inefficient. Here we present an efficient PCR protocol,
an optimized adaptor PCR method for genomic walking. Using a combination of a
touchdown PCR program and a special adaptor, the optimized adaptor PCR protocol
achieves high sensitivity with low background noise. By applying this protocol,
the insertion sites of a gene trap mouse line and two gene promoters from the
incompletely sequenced Xenopus laevis genome were successfully
identified with high efficiency. The general application of this protocol in
genomic walking was proved to be promising.

Key words        optimized
adaptor PCR; touchdown PCR; genomic walking; gene trap; promoter

In the postgenomic era, one major challenge is the functional
characterization of single gene. The gene trap method, using mouse embryonic stem
cells and a reporter vector randomly integrated into the genome, is a useful
tool to find novel genes and study their biological function [1]. To verify the
precise integration site, rapid and efficient genomic walking is required for
cloning the flanking sequences near to a gene trap vector.

The traditional approach is to screen the genomic library­ using a
specific probe, however, this strategy is laborious and time-consuming. Several
PCR-based methods for isolating­ unknown DNA fragments flanking a known
sequence­ have been developed. They are: (1) inverse PCR [2], which uses a pair
of reversed primers to amplify DNA sequences in self-circularized genomic
fragments, but it meets the limitation of restriction site distribution; (2)
randomly primed PCR [36], which amplifies with a known sequence-specific primer
and an arbitrary primer, but the non-specific amplification blocks its
application; and (3) ligation-mediated PCR [715]. The adaptor PCR method, which
uses an adaptor ligated to a genomic fragment, was carried out with a
locus-specific primer and an adaptor-specific primer. As this involved the use
of the adaptor-specific primer, the amplification of adaptor itself leads to
the generation of a high level of background noise. Several­ improved protocols
have emerged to overcome the drawbacks, but they are either complicated or
inefficient.

In this study, we describe an optimized adaptor PCR protocol
developed recently with the application of an optimized­ touchdown PCR program.
Using this protocol, the flanking sequences of a gene trap vector and two
promoters­ from the tetraploid animal Xenopus laevis were successfully
and rapidly isolated. The results indicated that the optimized adaptor PCR
would be valuable for genomic walking.

Materials and Methods

Isolation of genomic DNA and
restriction enzyme digestion­

Genomic DNA was extracted from mouse tail or Xenopus­ liver
as previously described [16]. Briefly, homogenized­ tissues were digested by proteinase
K overnight­ at 55 ºC. The genomic DNA was extracted twice with
phenol/chloroform, precipitated by ethanol, then washed with 75% ethanol and
finally dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The quality
of DNA was determined by the ratio of A
260/A280. One microgram­ of genomic DNA was digested overnight with 10 U of
restriction enzymes (New England Biolabs, Ipswich, USA) in 200
ml volume.

Oligonucleotide primers and
adaptor

The specific primers for each walking step were designed­ based on
the known sequence. Primers for the gene trap vector were: GT1, 5-CTCACCTTGCTCCTGCCGAGAAAGTATCCA-3;
GT2, 5-CGGAATTCGGGCTGACCGCTTCCTCGTGCTTTA-3. Primers for the Xenopus­
PAPC gene were: PAPC1, 5-CTCAGCTGCCCATCACTCTCACGGACT-3;
PAPC2, 5-CAATTACAGTGCCAGGGGGTTCTTCTTC-3. The upper strand for
the BamHI-specific adaptor was 5-GTAATACGACT­CACT­AT­AGGGCACGCGTGGTCGACGGCCCGGGCT­GGTctag-3, and the upper strand
for the HindIII-specific­ adaptor was 5-GTAAT­ACG­ACTCACTATA­GGGCA­CGCGTG­GTCG­ACGG­CCCGGGCTGGTtcga-3. The lower strand for
the adaptor was 5-PO
4agc­ttacca­gccc-NH2-3. Adaptor
primer AP1 was 5gtaatacgactcactataggc-3
and adaptor primer AP2 was 5acaatagggcacg­cgtggt-3.
The 5 end of the down strand of the adaptor was phosphorylated and an
amino group at the 3 end was modified. The same amount of upper strand
and down strand of the adaptor were denatured at 80 ºC for 10 min, then
annealed at room temperature for 30 min.

Generation of DNA
adaptor-linked digests

The ligation mixture contained 1 mg of digested genomic­
fragment, 1 U of T4 DNA ligase (New England Biolabs) and 50 mM adaptor in T4
DNA ligase buffer. The ligation reaction was carried out overnight at 16 ºC.
The genomic fragments ligated to the enzyme-specific adaptor were purified.

PCR amplification and cloning
of products

The first-round PCR amplification was carried out in a 50 ml of reaction
mixture containing 5
ml of LA buffer II (Mg2+ plus), 250 mM dNTP, 10 pM GSP, 10 pM AP1, 100 ng of adaptor-ligated genomic DNA,
and 2.5 U of LA Taq polymerase (TaKaRa, Takara, Japan). After pre-denaturing at
94 ºC for 3 min, the condition of the first 5 cycles was: denaturing at 94 ºC
for 30 s, annealing at 70 ºC for 30 s with extension at 72 ºC for 4 min. The
annealing temperature was reduced by 0.5 ºC per cycle. PCR parameters for the
proceeding 30 cycles were: denaturing at 94 ºC for 30 s, annealing at 60 ºC for
1 min with extension at 72 ºC for 4 min, and the final extension at 72 ºC for 5
min.

The second-round PCR was carried out in a 50 ml reaction­
mixture containing 1
ml of the first-round PCR product­ diluted 1:100, 2.5 U of LA buffer
II (Mg
2+ plus), 250 mM dNTP, 10 pM
AP1, 10 pM GSP2, and 2.5
ml of LA Taq polymerase. The PCR program was the same as indicated­
above. The second-round PCR product was run on a 1% agarose gel. Each band was
isolated by Gel Cleanup (Eppendorf, Hamburg, Germany) and cloned into pGEM-T
easy vector (Promega, Madison, USA). The positive clones were sequenced with
ABI PRISM
377 by Shanghai Biotech Company (Shanghai, China).

Southern blot

To produce a Southern blot probe specific to the gene trap vector,
the neomycin resistance gene was amplified and the genomic DNA from the gene
trap mouse line was prepared and digested overnight with HindIII and EcoRI
restriction enzymes. Digested DNA (10
mg per lane) was run on a 0.8% agarose gel and
transferred to Hybond N
+
nylon membrane (GE healthcare,
Piscataway, USA) and hybridized by a
32P-labeled probe using the Prime-a-Gene labeling kit (Promega). The
membrane was washed twice before autoradiographing at 70 ºC.

Sequence analyses

The sequence data were analyzed using the Editseq program from the
DNASTAR nucleotide sequence analysis package (Dnastar, Madison, USA) and searched in the mouse genome using
the BLAST program (http://www.ncbi.nlm.nig.gov/blast).

Results

Application of touchdown PCR
program for genomic walking

To analyze the precise insertion site of a gene trap vector, the genomic
walking from the gene trap vector is required. We found that all published
protocols have their disadvantages. Obviously, the traditional way of screening­
the genomic library is time-consuming. Also the inverse PCR and randomly primed
PCR methods have not been generally applied to walk in uncloned genomic DNA. An
improved adaptor PCR, which used a special adaptor, was reported to walk
upstream from one exon. However the protocol was very inefficient so that its
application was limited [17]. Although several attempts­ were made to increase
its sensitivity, the method became increasingly complicated and the application
was also limited [7]. According to this protocol (Table 1, protocol 1)
we attempted to identify the flanking sequence of a gene trapping mouse line,
8A21, but failed to get any amplified products [Fig. 1(A), lane 1].

Touchdown PCR is a method of PCR by which degenerate primers are
used to avoid amplifying nonspecific sequences [18]. It not only increases
specificity but also enhances yield. Its applications in genomic walking have
been mentioned in some published works [19]. However there is no published
report on applying the touchdown PCR to the adaptor PCR method. We then thought
to combine these two methods in order to increase the PCR efficiency. The
combination of touchdown PCR to adaptor PCR (Table 1, protocol 2) indeed
increased the yield of PCR products, but its smear pattern in agarose gel
argues the amplification specificity of this protocol [Fig. 1(A), lane
2].

In the classic touchdown program, the annealing temperature­ is
reduced by 2 ºC per cycle, and this is the parameter we used in protocol 2.
However, we have accumulated­ data indicating that scaling down the touchdown­
PCR parameters, in terms of slowly reducing the annealing temperature, was the
key step in keeping the specificity of the touchdown PCR program (unpublished
data). We then developed the third protocol, in which the annealing temperature
was lowered by 0.5 ºC per cycle (Table 1, protocol 3) and found it worked
perfectly in producing sharp PCR products (Fig. 1, lane 3). Three bands
of 3.4 kb (F1), 2.1 kb (F2) and 300 bp (F3) in length were obtained­ from the
gene trapping mouse line, 8A21. Sequence analysis showed that one of the three
specific bands, F1 [Fig. 1(A), lane 3], contained a 597 bp trapping
vector sequence in reverse to a 3.2 kb trapping vector sequence, indicating the
two trapping vectors tandemly, but reversely, integrated into the genome [Fig.
1(B)
, F1]. The second, F2, contained the 597 bp trapping vector sequence
together with a 1.5 kb sequence; and we searched the currently available mouse
genome database using the BLAST program, and it revealed that the trapping­
vector was inserted into mouse chromosome 4 A5 loci encoding a P4 ATPase [Fig.
1(B)
, F2]. F3 was a non-specific amplificon. Thus, two insertion sites,
with their flanking sequences, were identified only by our optimized adaptor
PCR.

Southern blot analysis was carried out using the gene trap
vector-specific probe to identify the number of insertion­ sites. The genomic
DNA extracted from the gene trap mouse line was digested with HindIII or
EcoRI restriction enzyme­ and transferred onto the nylon membrane. Two
insertion sites were characterized, as shown in Fig. 1(C). This result­
supports the fact that optimized adaptor PCR can accurately identify multiple
trapping vector insertion­ sites.

It requires only two rounds of PCR to get mouse gene trap insertion
sites, which is much quicker than all pre­viously reported methods for cloning
flanking sequences. The rapid and efficient simultaneous cloning of multiple
insertion sites indicates that the optimized PCR would be a useful tool to
verify gene trap insertion sites.

Cloning PAPC promoter from Xenopus laevis

Encouraged by the rapid cloning of the trapping insertion­ site, we
then used the optimized adaptor PCR protocol to isolate the promoter of the X.
laevis
PAPC gene, as the genome of X. laevis has not yet been
sequenced. Two specific primers, PAPC1 and PAPC2, were designed based on the sequence
adjacent to the Xenopus PAPC transcription start site. The
genomic DNA was isolated from the Xenopus liver and digested with a
restriction enzyme, HindIII. The purified genomic fragments were ligated
to the HindIII adaptor. Three protocols with different PCR conditions as
shown in Table 1 were also simultaneously­ applied for genomic walking.
After two rounds of PCR, the PCR products were analyzed by gel electrophoresis.
As shown in Fig. 2(A), a band of approximately 5 kb was amplified from HindIII-specific
adaptor-ligated genomic DNA [Fig. 2(A), lane 3]; while there was no
obvious bands in the two former protocols [Fig. 2(A), lanes 1 and 2].
The specific band F was isolated and sequenced. Sequence analysis indicated
that F was related to Xenopus PAPC promoter.

We also used the same protocol to isolate the promoter of mespo,
another Xenopus gene, and got the same sharp results (data not shown).
In each case the whole procedure, from preparing tissues to obtaining
sequences, took only one week. Thus, the feasibility of this approach in
cloning sequences flanking a gene/vector from different genomes is evident.

Discussion

Three kinds of PCR strategies were developed for chromosome­ walking:
inverse PCR [2]; random primer PCR [36]; and ligation-mediated PCR [815].
Inverse PCR is used less for chromosome walking because of the limitation of
available restriction sites in the unknown/known region or poor circularization
of the template molecule. Ligation-mediated PCR and random primer PCR are more
popular for chromosome walking. The latter is the simplest­ and most popular
method for identification of T-DNA or transposon insertions, but its amplified
products­ are general­ly small (<1 kb). To obtain larger fragments­ (>1
kb) or to walk step by step, we usually resort to ligation-mediated PCR.
However, this is an inefficient­ strategy because, in most cases, non-specific
amplification accounts for the major proportion of the final PCR products. To
increase its specificity, an improved­ adaptor PCR using a special adaptor has
been developed [7]. However,the genomic complexity from different species­ and
low effiencent PCR program would make amplification­ efficiency lower,blocking
its applications. Several­ improved ligation-mediated­ PCRs increase­ the
amplification­ efficiency but their manipulations­ are complicated. Here we
combined the touchdown PCR with the adaptor PCR and scaled down the parameters,
developing an optimized touchdown PCR protocol. Slowly lowering the annealing
temperature makes primers find their targets precisely, so they yield specific
products efficiently. By simple modification of the PCR program, our optimized
touchdown PCR protocol could largely improve­ the application of adaptor PCR in
genome research.

We believe that the optimized adaptor PCR is a powerful­ tool in the
following genome-related experiments: (1) identifying gene trap or other
transgenic vector insertion sites, especially multi-copy insertions; (2) isolating
flanking sequences­ from known sequences, such as cloning a gene promoter from
a cDNA fragment; (3) filling the gaps in genome sequencing; and (4) obtaining
non-conserved regions­ of genes in uncharacterized species, according to the
conserved sequences of reported genes.

In our experiments, we found several key points for the successful
application of the optimized adaptor PCR. First, the touchdown rate should be
slow; in our case, the rate of 0.5 ºC worked perfectly in amplifying the target
bands. Second, genomic DNA with a very high average molecular­ weight should be
digested efficiently by enzyme. Finally, gene-specific primers should be highly
specific, preferably­ approximately 2530 nucleotides long, and hairpin
sequences­ and primer dimmers should be avoided.

Acknowledgements

We thank Dr. Babara I. Meyer
and Dr. Ulrike Teichmann (Department
of Molecular Cell Biology, Max-Plank Institutes of Biophysical Chemistry,
Gotingen, Germany) for kindly
providing gene trap mouse lines and Dr. Yuan-xin
Hu (Institutes of Biochemistry
and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese­ Academy
of Sciences, Shanghai, China) for technical­ help with Southern blot. We are
also grateful to Dr. Xu-dong Zhao (Department of Medical Genetics,
Shanghai Jiaotong University School of Medicine, Shanghai, China) for
discussion. We thank Dr. Cheng-fu
Sun and Dr. Shuang-wei Li
(Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological
Sciences, Chinese­ Academy of Sciences) for their critical reading of this
manuscript.

References

 1   Cecconi F, Meyer BI. Gene
trap: a way to identify novel
genes and unravel their biological function. FEBS Lett 2000, 480: 63
71

 2   Keim M, Williams RS,
Harwood AJ. An inverse PCR technique to rapidly isolate the flanking DNA of
dictyostelium insertion mutants. Mol Biotechnol 2004, 26: 221
224

 3   Parker JD, Rabinovitch
PS, Burmer GC. Targeted gene walking polymerase chain reaction. Nucleic Acids
Res 1991, 19: 3055
3060

 4   Liu YG, Whittier RF.
Thermal asymmetric interlaced PCR: Automatable amplification and sequencing of
insert end fragments from P1 and YAC clones for chromosome walking. Genomics
1995, 25: 674
681

 5   Liu YG, Mitsukawa N,
Oosumi T, Whittier RF. Efficient isolation and mapping of Arabidopsis
thaliana
T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant
J 1995, 8: 457
463

 6   Terauchi R, Kahl G. Rapid
isolation of promoter sequences by TAIL-PCR: the
5-flanking regions of Pal and Pgi genes from yams (Dioscorea).
Mol Gen Genet 2000, 263: 554
560

 7   Siebert PD, Chenchik A,
Kellogg DE, Lukyanov KA, Lukyanov SA. An improved PCR method for walking in
uncloned genomic DNA. Nucleic Acids Res 1995, 23: 1087
1088

 8   Garrity PA, Wold BJ.
Effects of different DNA polymerases in ligation-mediated PCR: enhanced genomic sequencing and in
vivo
footprinting. Proc Natl Acad Sci USA 1992, 89: 1021
1025

 9   Warshawsky D, Miller L. A
rapid genomic walking technique based on ligation-mediated PCR and magnetic
separation technology. Biotechniques 1994, 16: 792
794, 796, 798

10  Rosenthal A, Jones DS. Genomic
walking and sequencing by oligo-cassette mediated polymerase chain reaction.
Nucleic Acids Res 1990, 18: 3095
3096

11  Rosenthal A, MacKinnon RN,
Jones DS. PCR walking from microdissection clone M54 identifies three exons
from the human gene for the neural cell adhesion molecule L1 (CAM-L1). Nucleic
Acids Res 1991, 19: 5395
5401

12  Sterky F, Holmberg A,
Alexandersson G, Lundeberg J, Uhlen M. Direct sequencing of bacterial artificial
chromosomes (BACs) and prokaryotic genomes by biotin-capture PCR. J Biotechnol
1998, 60: 119
129

13  Mueller PR, Wold B. In vivo
footprinting of a muscle specific enhancer by ligation mediated PCR. Science
1989, 246: 780
786

14  Jones DH, Winistorfer SC.
Sequence specific generation of a DNA panhandle permits PCR amplification of
unknown flanking DNA. Nucleic Acids Res 1992, 20: 595
600

15  Dai SM, Chen HH, Chang C, Riggs
AD, Flanagan SD. Ligation-mediated PCR for quantitative in vivo
footprinting. Nat Biotechnol 2000, 18: 1108
1111

16  Sambrook J, Russell DW.
Molecular Cloning: A Laboratory Manual. 3rd ed. New York: Cold Spring Harbor
Press 2001

17  Reddy MK, Nair S, Sopory SK. A
new approach for efficient directional genome walking using polymerase chain
reaction. Anal Biochem 2002, 306: 154
158

18  Don RH, Cox PT, Wainwright BJ,
Baker K, Mattick JS. “Touchdown” PCR to circumvent spurious priming
during gene amplification. Nucleic Acids Res 1991, 19: 4008

19  Levano-Garcia J,
Verjovski-Almeida S, da Silva AC. Mapping transposon insertion sites by
touchdown PCR and hybrid degenerate primers. Biotechniques 2005, 38: 225-229