Categories
Articles

ABBS 2005,38(08): Disruption Effect of Microplitis bicoloratus Polydnavirus EGF-like Protein, MbCRP, on Actin Cytoskeleton in Lepidopteran Insect Hemocytes


Original Paper

Pdf
file on Synergy
OPEN

omments

Acta Biochim Biophys
Sin 2006, 38: 577-585

doi:10.1111/j.1745-7270.2006.00195.x

Disruption Effect of Microplitis
bicoloratus
Polydnavirus EGF-like Protein, MbCRP, on Actin Cytoskeleton in
Lepidopteran Insect Hemocytes

Kai-Jun LUO1,2
and Yi PANG
1*

1 State Key Laboratory of Biocontrol and
Institute of Entomology, Sun Yat-Sen University, Guangzhou 510275, China;

2 Agricultural Environment and Resource
Research Institute, Yunnan Academy of Agricultural Sciences, Kunming 650205,
China

Received: March 23,
2006       

Accepted: April 29,
2006

This work was
supported by the grants from the Major State Basic Research Development Program
of China (No. G2000016209), the National Natural Science Foundation of China
(No. 30530540) and Open-funding of the State Key Laboratory of Biocontrol at
Sun Yat-Sen University (No. 0404)

*Corresponding
author: Tel, 86-20-84113860; Fax, 86-20-84037472; E-mail, [email protected]

Abstract        Microplitis bicoloratus is a braconid endoparasitic
wasp associated with the polydnavirus named Microplitis bicoloratus bracovirus
(MbBV). Parasitism of Spodoptera litura larvae leads to an impaired­
cellular immune response and to the disappearance of the 42 kDa actin in host
hemocytes. In this work, we investigated if the absence of actin in blood cells
was related to MbBV infection. An MbBV gene similar to egf-like genes
identified in another bracovirus was partially cloned and named Mbcrp1.
The full-length gene, named Mbcrp, is transcribed throughout the course
of parasitism in host hemocytes and the 30 kDa MbCRP protein was detected in
hemocytes 6
7 d post-parasitization. The Mbcrp1
gene contains the cysteine-rich trypsin inhibitor-like (TIL) domain coding
sequence and the expression of recombinant MbCRP1 inhibited the expression of
the 42 kDa actin in Hi5 cells. The 34.1 kDa MbCRP1-green fluorescent protein
fusion protein locate specifically in the cytoplasm. These results suggest that
expression of MbCRP in lepidopteran insect cells is related to the disruption
of the actin cytoskeleton.

Key words        actin cytoskeleton; polydnavirus; Microplitis
bicoloratus
; cellular immune response; trypsin inhibitor-like domain;
MbCRP1

The Polydnaviridae family consists of segmented, double-stranded DNA
viruses that are specifically associated­ with certain types of parasitoid
wasps [1]. Polydnaviruses (PDVs) are divided into two families, bracoviruses
(BVs) and ichnoviruses (IVs) that coexist with wasps from the families
Braconidae and Ichneumonidae, respectively [2]. The virion morphologies of BVs
and IVs differ significantly. BVs have cylindrical nucleocapsids of various
lengths, with virions made of one or more nucleocapsids surrounded by a single
membrane, whereas those of IVs have lenticular nucleocapsids of uniform size,
individually surrounded by two membranes [2,3]. Nevertheless, for both BVs and
IVs, virion assembly takes place in the nuclei of calyx cells situated between
the ovarioles and lateral oviducts, and viral particles are injected in the
lepidopteran along with the wasp’s egg. The expression of a viral gene causes
the suppression of the host’s immune system that is essential for the survival
of the parasitoid’s progeny [1,4
6].

PDVs can infect most larval tissues, particularly hemocytes [7,8]. In
parasitized host larvae, hemocytes might become apoptotic [5,9] or lose their
ability to adhere­ to a substrate [4,9
12]. Some polydnaviral genes are reportedly­
involved in hemocyte function disruption. For example, Glc1.8, a protein
encoded by the Microplitis demolitor bracovirus (MdBV), induces a loss
of adhesion and phagocytosis in insect Hi5 and S2 cells [13]. Cr1, a protein
encoded by the Cotesia congregata bracovirus, prevents cell surface
exposure of lectin-binding sites and microparticle formation during immune
stimulation of hemocytes. Cr1 is a secreted glycoprotein that has been
implicated in depolymerization of the actin cytoskeleton of hemocytes,
resulting in hemocyte inactivation [14]. Despite evidence that PDV infection is
correlated with hemocyte cytoskeleton disruption, the mechanisms by which PDV
proteins affect the cytoskeleton remain unclear.

MdBV encodes three genes, egf1.0, egf1.5 and egf0.4
(GenBank accession No. U76034, U76033 and DQ000240, respectively), which are
characterized by an epidermal growth factor-like cysteine-rich motif and an
amino-terminal trypsin inhibitor-like (TIL) domain [15,16]. The MdBV egf
genes are transcribed 12
24 h post-parasitization (p.p.) and the peak of their expression
coincides with physiological changes observed in host hemocytes. This suggests
that the proteins encoded by egf genes are related­ to immune
suppression [15].

The closely related species Microplitis bicoloratus is a
parasitoid of Spodoptera litura larvae and is associated with the Microplitis
bicoloratus
bracovirus (MbBV). As for other parasitoids, parasitization of S.
litura
larvae by M. bicoloratus leads to suppression of the immune
response­ and developmental arrest of the host larvae. Interestingly, we
found that parasitism was correlated with an absence of 42 kDa actin in S.
litura
hemocytes.

In the present study, we isolated a sequence from MbBV using primers
designed according to MdBV egf sequences which was named Mbcrp1.
The recombinant MbCRP1 contains a TIL domain, and is concomitant with actin
decrease in infected Hi5 cells. We also detected a 30 kDa protein, MbCRP, in
hemocytes 6
7 d post-parasitization using antiserum of the recombinant MbCRP1.

Materials and Methods

Cell lines, polydnavirus and
parasitoid rearing

Spodoptera frugiperda (Sf9) and Trichoplusia
ni
(Hi5) cells were maintained in Grace’s medium (Gibco BRL, Gaithersburg,
USA) supplemented with 10% fetal bovine serum.

The parasitoid colony was maintained on S. litura larvae­
reared in the laboratory; adults were provided honey as a dietary supplement.
MbBV DNA was extracted and analyzed­ according to established methods [17].

Electron microscopy

Reproductive tracts of M. bicoloratus females were pulled out
in Pringle’s solution [18]. Isolated ovaries were fixed in 2.5% glutaraldehyde
overnight at 4 ºC, washed three times with phosphate-buffered saline (PBS)
buffer (pH 7.2) and post-fixed in 1% osmium tetroxide in PBS for 1 h at 4 ºC.
After fixation, ovaries were washed three times with PBS buffer, dehydrated in
graded ethanol and soaked in acetone. Samples were embedded in Spurr’s resin.
Ultra-thin sections were stained with uranyl acetate and lead citrate and
observed under a JEM-100CXII transmission electron microscope (Jeol, Tokyo,
Japan) operating at 100 kV.

For negative staining, ovaries isolated from three female wasps were
placed in 50
ml ice-cold Pringle’s solution and gently dissected to allow the
calyx fluid to diffuse. The extract was then centrifuged at 1000 g for 3
min to remove cellular debris and eggs. The supernatant was adsorbed on a
Formvar-coated (Nisshin EM) electron microscopy grid stained with 2%
phosphotungstic acid, dried on filter paper and observed with the JEM-100CXII
microscope.

egf-like gene cloning

Two primers were designed based on sequence alignment of MdBV egf
genes. These primers, P1S, 5-CACCTGCTTTTCCTGTTTGCATTTT-3 and
P1A, 5-CCGTTTTGAAGAATCATTGTTGGC-3, correspond to the N-terminal
cysteine-rich conversed region of MdBV egf genes. To isolate an egf-like
gene from MbBV, a polymerase­ chain reaction (PCR) was carried out using MbBV
DNA as a template. The amplified fragment was cloned into pMD18-T (TaKaRa,
Dalian, China) vector and sequenced. The sequence was named Mbcrp1 and
submitted­ to GenBank with accession No. DQ286649. 

Sequence analysis

Nucleotide BLAST searches were carried out against the GenBank nr
database at the National Centre for Biotechnology Information website (www.ncbi.nlm.nih.gov/blast). Protein
analysis tools were found at the ExPASy molecular biology server (http://au.expasy.org/tools) and
EMBL-EBI (http://www.ebi.ac.uk).

Plasmid construction and
preparation of MbCRP1 antiserum

Two primers were designed to amplify the coding­ sequence of Mbcrp1
with open reading frame­ using MbBV DNA as a template: P2S­, 5GGATCCATGCCTACTAAAGAAAGTGA-3
(BamHI site underlined); and P2A, 5GTCGACTTAGTTGTAATAGCAGTAAA-3
(SalI site underlined). The amplified fragment was cloned into pMD18-T
vector, then into the expression vector pQE30 (Qiagen, Hilden, Germany) with a
6
´His-tag sequence. The resulting plasmid pQE30-MbCRP1 was checked by
sequencing and transformed into Escherichia coli M15.

The Mbcrp1 expression under control of bacteriophage T5
promoter in E. coli M15 was induced with 1 mM isopropyl-
bD-thiogalactopyranoside
as recommended by the manufacturer (Qiagen). Expressed 6
´His-MbCRP1 was purified from E. coli M15 by Ni-NTA agarose
under denaturing­ conditions as described in the handbook (QIAexpressionist;
Qiagen). Purified 6
´His-MbCRP1
protein­ was used to raise antiserum in rabbits according to the method
described by Sambrook et al. [19] using Freund’s adjuvant (Gibco BRL).

Reverse
transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted using the Qiagen RNA Kit (Invitrogen,
Valencia, USA). For S. litura larvae, total RNA was isolated­ from 100
ml hemocytes
recovered from non-parasitized and parasitized S. litura larvae. For Hi5
cells, total RNA of Hi5 cells was isolated from 510
5
mock-infected and recombinant baculovirus (see below) infected Hi5 cells at
multiplicity of infection (MOI) of 5 at various time points post-infection
(p.i.).

RT-PCR was carried out using an RNA-PCR-AMV Kit (Version 2.1;
TaKaRa) with 3
mg of total RNA as the template. First-strand cDNA was synthesized
using avian myeloblastosis virus (AMV) reverse transcriptase and random 9-mer
according to the manufacturer’s instructions. The cDNA mixture was amplified
with MbCRP1-specific primers­ P2S and P3A-5TCTAGAGTTGTAATAGCAGT­AAA-3
(XbaI site underlined). The obtained PCR products­ were analyzed in 1.0%
agarose gel.

Construction and
identification of the recombinant viruses­

Transfer-vector plasmids were constructed to generate­ recombinant
AcMNPV expressing MbCRP1 protein. MbCRP1 was cloned into the BamHI and XbaI
sites of the pFastBacI vector (Invitrogen, Rockville, USA). Green fluorescent protein
(GFP) gene was also cloned into the XbaI and PstI sites of
pFastBac-MbCRP1 vector as a C-terminus fusion to MbCRP1. pFastBacI vector was
used as a control. The pFastBac-MbCRP1-GFP and pFastBac-GFP vectors were
transformed into E. coli DH10Bac cells (Gibco BRL) and positive colonies
were selected as described­ by the manufacturer. To obtain recombinant viruses,
high molecular mass DNA was purified from the selected colonies as recommended
by the manufacturer and transfected into Sf9 cells. The recombinant baculo­viruses
Ac-MbCRP1-GFP and Ac-GFP, named reAcMG and reAcG, respectively, were amplified
to passage­ 3 in Sf9 cells. Titers of recombinant viruses were determined by
tissue culture infectious dose 50 assay with infected Sf9 cells.

Collection of protein samples
in hemocytes and Western­ blot analysis

S. litura larvae were bled from a proleg
on ice. A total of 50
100 ml of hemocytes was pooled at various­ time points and centrifuged at
3000 g for 3 min. Supernatant (cell-free hemolymph) was collected and
one volume of 2
´sodium dodecylsulfate (SDS) loading
buffer was added. The cellular pellet was resuspended in 50
ml of double
distilled water and one volume of 2
´SDS
loading buffer was added. Equal non-heated protein samples were electrophoresed
on denaturing 12% SDS-polyacrylamide gels [20]. Protein bands were either
stained with Coomassie brilliant blue or transferred to a nitrocellulose
membrane (Schleicher and Schuell, Dassel, Germany) as described earlier [19].
The membranes were blocked with 1% blocking­ solution (Roche, Mannheim,
Germany) then probed with anti-MbCRP1 antiserum at a dilution of 1:200.
Immunoreactive proteins were visualized using goat anti-rabbit immunoglobulin G
and Ap-conjugate (Roche) following­ the protocol provided by the manufacturer.
Actin­ blots were probed with a 1:5000 dilution of anti-actin (Calbiochem, San
Diego, USA) and visualized with Ap-conjugated goat anti-mouse secondary
antibodies at a 1:10,000 dilution (Roche).

Assessment of transcription
and expression of MbCRP1 in infected Hi5 cells

Transcription and expression of MbCRP1 in infected Hi5 cells was
assessed by RT-PCR and Western blot. Hi5 cells were seeded at a density of 5
´105 cells per well in a 35 mm plate (Corning,
Corning, USA). Cells were infected with recombinant virus at MOI of 5. Cells
were harvested 6
72 h p.i.. RT-PCR and Western blot were carried out as described
above.

Fluorescence microscopy

Hi5 cells (1´105) were grown on glass cover slips in 35 mm Petri dishes (Corning)
and infected with reAcMG and reAcG at MOI of 5. At 1248 h p.i., the cells were
examined­ with a confocal-laser scanning fluorescence microscope (Leica SDK;
Leica, Heidelberg, Germany).

Results

The virion morphology and DNA
analysis of MbBV

The polydnavirus associated with M. bicoloratus is a typical
bracovirus, as indicated by virion morphology and genome characteristics. The
negative staining of MbBV virions showed evident tail-like appendages [Fig.
1(A)
, arrows] and heads [Fig. 1(A), asterisks]. The particles
consisted primarily of one or more nucleocapsids surrounded by a single
envelope [Fig. 1(B), arrows]. The MbBV genome had estimated 11 segments
ranging from 8000 to 50,000 bp [Fig. 1(C)].

The cloning of a partial egf-like gene in MbBV

Due to the congeneric nature of MbBV and MdBV, we expected that the
MbBV genome can also encode members of the egf-like family. Therefore we
used primers designed in conserved regions of MdBV egf genes and
obtained a 652 nt amplifier using MbBV DNA as a template. Sequencing confirmed
that the amplified fragment was the 5 region of an egf-like gene
(BlastN e-value=5e
131; BlastX e-value=4e11). The full egf-like gene was named Mbcrp,
and the fragment we obtained was named Mbcrp1. Alignment with MdBV
genomic sequences indicated that the Mbcrp1 contains partial exon
sequence of Mbcrp encoding­ the TIL domain (data not shown). This was confirmed
by InterPro Scan and MotifScan analysis of MbCRP1 that MbCRP1 consists of 61
amino acids and contains a TIL domain (Fig. 2) encompassing a
cysteine-rich repeat, located in position 35
51. And egf motif is
absent in the Mbcrp1.

MbCRP is expressed in
hemocytes of S. litura larvae naturally parasitized by M. bicoloratus

Transcription of Mbcrp1 in hemocytes of naturally parasitized
S. litura larvae was examined by RT-PCR and Western­ blot (Fig. 3).
A band of 195 bp was detectable 1
7 d p.p., although the bands were very faint 13 d p.p. [Fig.
3(A)
]. This indicated that the Mbcrp gene is transcribed in S.
litura
hemocytes and transcription appears to be persistent during
parasitoid larval development.

This result was confirmed by Western blot analysis. Indeed, in
parasitized S. litura, the MbCRP1 antiserum recognized a specific
protein of approximately 30 kDa (putative MbCRP protein) in larvae hemocyte
lysate. The 30 kDa band was observed 6 and 7 d p.p. in hemocyte lysate [Fig.
3(B)
] but was absent from cell-free hemolymph (data not shown). This
indicated that the putative MbCRP protein was present only within the cell.

Effects of M. bicoloratus
parasitism on actin in S. litura hemocytes

To test the effects of M. bicoloratus parasitization on actin
in hemocytes, we analyzed expression of the 42 kDa actin in hemocyte lysate
collected from parasitized S. litura larvae. In our experiments, the
monoclonal anti-actin antibody­ recognized the 42 kDa actin. Western blot
analysis­ showed that this monoclonal antibody recognized the 42 kDa band only
in hemocytes from non-parasitized larvae [Fig. 3(C), lane U].
Indeed, no signal was detected in hemocytes of parasitized larvae 3
7 d p.p.. This
result suggests that the expression of the 42 kDa actin is inhibited­ by
parasitism, which might lead to the disappearance of functional actin filaments
in S. litura hemocytes.

Transcription and expression
of MbCRP1 in Hi5 cells infected by reAcMG and effects of infection on actin of
Hi5 cells

To further investigate if there is a link between absence of actin
and expression of MbCRP in infected lepidopteran cells, we constructed a
recombinant baculovirus expressing the MbCRP1 TIL domain of MbCRP and analyzed
expression­ of actin in the baculovirus-infected Hi5 insect cell line.

After infection of the Hi5 cell line with the baculovirus reAcMG,
transcription of MbCRP was analyzed by RT-PCR. The 195 bp PCR-amplified
fragment corresponding to Mbcrp1 was detected as early as 6 h p.i. and
continued­ to be present until 72 h p.i. [Fig. 4(A)]. Hi5 cells were
thus successfully infected by recombinant baculovirus reAcMG and MbCRP1 was
persistently transcribed in infected­ cells. Western blot analysis using the
anti-MbCRP1 antiserum confirmed the presence of the 34.1 kDa MbCRP1-GFP fusion
protein in infected Hi5 cell lysate [Fig. 4(B)]. The 34.1 kDa
band was first detected­ 12 h p.i., with a peak of expression 48 h p.i., then
expression clearly declined 72 h p.i. [Fig. 4(B)].

Expression of 42 kDa actin in Hi5 cells infected by reAcMG and reAcG
was analyzed by Western blot. The 42 kDa band was detected in mock-infected Hi5
cells [Fig. 4(C,D), lane Mi] and in Hi5 cells infected by
reAcG recombinant virus 6
72 h p.i. [Fig. 4(D)]. In contrast, in Hi5 cells
infected by reAcMG the 42 kDa band was detected 6
24 h p.i., but was absent
48
72
h p.i. [Fig. 4(C)]. Therefore, in baculovirus-infected Hi5 cells,
expression of MCRP1 seems to be correlated with an absence of 42 kDa actin
expression.

At the time when MbCRP1 shows a peak of expression and 42 kDa actin
is no longer expressed, approximately 48 h p.i., Hi5 cells infected with reAcMG
had lost their adhesive properties and floated in the culture medium. In
contrast, cells infected with reAcG remained attached to the dishes. This
observation confirms the hypothesis that MbCRP1 is in some way related to
disruption of the actin cytoskeleton of Hi5 cells.

The subcellular localization of the MbCRP1 protein was investigated
using confocal laser scanning microscopy. Hi5 cells were infected with reAcG
and reAcMG, incubated­ and examined for fluorescence at various time points
p.i. (Fig. 5). GFP alone showed homogeneous fluorescence in the
cytoplasm and nucleus 12
48 h p.i. The MbCRP1-GFP fusion protein was localized predominantly
in the cytoplasm.

Discussion

Our study indicates that the presumed cysteine-rich EGF-like protein­
MbCRP of MbBV is probably related to the disruption of the actin cytoskeleton
observed in the hemocytes of S. litura larvae parasitized by M.
bicoloratus
. Indeed, we found that infection of lepidopteran cell lines
with a baculovirus expressing the MbCRP TIL domain resulted in inhibition of
expression of the 42 kDa actin. Moreover, in infected cell lines, the peak
expression of MbCRP1 coincided with the complete disappearance of the 42 kDa
actin [Fig. 4(B,C)].

In parasitized S. litura larvae, Mbcrp1 is transcribed
in host hemocytes throughout the course of parasitism [Fig. 3(A)] and
the MbCRP protein is detected in the cytoplasm of polydnavirus-infected
hemocytes 6
7 d p.p. using MbCRP antiserum [Fig. 3(B)]. By this time, the
42 kDa actin is no longer expressed in hemocytes [Fig. 3(C)].

Cytoskeletal proteins are found in highly organized arrays­ within
the cytoplasm of higher eukaryotic cells. These proteins are intimately
involved in functions such as cell and intracellular organelle movement,
maintenance of cell shape and endocytosis [21,22]. The cytoskeleton of most
eukaryotic cells includes the microfilaments composed­ of actin, the
microtubules composed of tubulin­ and the intermediate filaments composed of
vimentin or desmin.

The absence of functional actin filaments in MbCRP-expressed cells
was probably the primary cause of cells or hemocyte inactivation. Although
little is known about the molecular mechanisms leading to hemocyte activation,
processes such as attachment, aggregation [23,24] and coagulation reaction [25]
involve complex rearrangement of the actin cytoskeleton [26]. In vitro,
the expression of the MdBV glc1.8 causes the disruption of F-actin in
the cytoplasm and induces the accumulation of F-actin at the periphery of cells
leading to a loss of adhesion by hemocyte-like cell lines, namely, Hi5 [14]. In
our study, the expression of recombinant MbCRP1 also greatly reduced­ the
ability of these cells to adhere to a substrate, which was probably linked to
the absence of the 42 kDa actin (Fig. 4). Some other PDV genes have been
implicated­ in disruption of the actin cytoskeleton but their subcellular­ localizations
were distinctly different: Glc1.8 protein localized­ to the surfaces of
infected cells [13] and Cr1 protein was secreted [14], whereas MbCRP localized
in the cytoplasm (Fig. 5).

The unique intracellular location of MbCRP
protein suggested­ it is probably involved in specific roles within the actin
cytoskeleton. Further studies would be necessary­ to investigate whether MbCRP
protein is an actin-binding protein or not, through protein-protein
interactions. In our experiments, we also found that the 42 kDa actin declined
in Hi5 cells infected by reAcG at 48 and 72 h p.i. [Fig. 4(D)]. We
presume that this side-effect might cause due to Bac-to-Bac expression system.
To test this hypothesis, other insect cell expression systems should be used in
further research.

References

 1   Webb BA, Strand MR. The biology and genomics
of polydnaviruses. In: Gilbert LI, Iatrou K, Gill SS eds. Comprehensive
Molecular Insect Science. San Diego: Elsevier Press 2004

 2   Webb BA, Beckage NE, Hayakawa Y, Krell PJ, Lanzrein
B, Strand MR, Stoltz DB et al. Polydnaviridae. In: van Regenmortel MHV,
Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J et al.
eds. Virus Taxonomy. San Diego: Academic Press 2000

 3   Stoltz DB. The polydnavirus life cycle. In:
Beckage NE, Thompson SN, Federici BA eds. Parasites and Pathogens of Insects.
San Diego: Academic Press 1993

 4   Schmidt O, Theopold U, Strand MR. Innate
immunity and its evasion and suppression by hymenopteran endoparasitoids.
Bioessays 2001, 23: 344
351

 5   Strand MR, Pech LL. Immunological basis for
compatibility in parasitoid-host relationships. Annu Rev Entomol 1995, 40: 31
56

 6   Webb BA. Polydnavirus biology, genome
structure and evolution. In: Miller LK, Ball AL eds. The Insect Viruses. New
York: Plenum Press 1998

 7   Stoltz DB, Vinson SB. Penetration into
caterpillar cells of virus-like particles injected during oviposition by
parasitoid ichneumonid wasps. Can J Microbiol 1979, 25: 207
216

 8   Wyder S, Blank F, Lanzrein B. Fate of
polydnavirus DNA of the egg-larval parasitoid Chelonus inanitus in the
host Spodoptera littoralis. J Insect Physiol 2003, 49: 491
500

 9   Amaya KE, Asgari S, Jung R, Hongskula M,
Beckage NE. Parasitization of Manduca sexta larvae by the
parasitoid wasp Cotesia congregata induces an impaired host immune
response. J Insect Physiol 2005, 51: 505
512

10  Lavine MD, Strand MR. Insect hemocytes and
their role in immunity. Insect Biochem Mol Biol 2002, 32: 1295
1309

11  Lavine MD, Beckage NE. Polydnaviruses: Potent
mediators of host insect immune dysfunction. Parasitol Today 1995, 11: 368
378

12  Asgari S, Hellers M, Schmidt O. Host haemocyte
inactivation by an insect parasitoid: Transient expression of a polydnavirus
gene. J Gen Virol 1996, 77: 2653
2662

13  Beck M, Strand MR. Glc1.8 from Microplitis
demolitor
bracovirus induces a loss of adhesion and phagocytosis in insect
high five and S2 cells. J Virol 2005, 79: 1861
1870

14  Asgari S, Schmidt O, Theopold U. A
polydnavirus-encoded protein of an endoparasitoid wasp is an immune suppressor.
J Gen Virol 1997, 78: 3061
3070

15  Strand MR, Witherell RA, Trudeau D. Two Microplitis
demolitor
polydnavirus mRNAs expressed in hemocytes of Pseudoplusia
includens
contain a common cysteine-rich domain. J Virol 1997, 71: 2146
2156

16  Trudeau D, Witherell RA, Strand MR.
Characterization of two novel Microplitis demolitor polydnavirus mRNAs
expressed in Pseudoplusia includens haemocytes. J Gen Virol 2000, 81:
3049
3058

17  Albrecht U, Wyler T, Pfister-Wilhelm R, Gruber
A, Stettler P, Heiniger P, Kurt E et al. Polydnavirus of the parasitic
wasp Chelonus inanitus (Braconidae): Characterization, genome
organization and time point of replication. J Gen Virol 1994, 75: 3353
3363

18  Pringle JHW. Proprioception in insects. J Exp
Biol 1938, 15: 101
103

19  Sambrook J, Fritsch EF, Maniatis T. Molecular
Cloning: A Laboratory Manual. 2nd ed. New York: Cold Spring Harbor Laboratory
Press 1989

20  Laemmli UK. Cleavage of structural proteins
during the assembly of the head of bacteriophage T4. Nature 1970, 227: 680
685

21  Mitchison TJ, Cramer LP. Actin-based cell
motility and cell locomotion. Cell 1996, 84: 371
379

22  Yeaman C, Grindstaff KK, Nelson WJ. New
perspectives on mechanisms involved in generating epithelial cell polarity.
Physiol Rev 1999, 79: 73
98

23  Gupta AP. Insect immunocytes and other
hemocytes: Roles in humoral and cellular immunity. In: Gupta AP ed. Immunology
of Insects and Other Arthropods. Boca Raton: CRC Press 1991

24  Ratcliffe NA. Cellular defense responses of
insects: Unresolved problems. In: Beckage NE, Thompson SN, Federici BA eds.
Parasites and Pathogens of Insect Species. San Diego: Academic Press 1993

25  Bohn H. Hemolymph clotting in insects. In:
Berlin MB, ed. Immunity in Invertebrates. Berlin/Heidelberg: Springer-Verlag
Press 1986

26  Gruenheid S, Finlay BB. Microbial pathogenesis
and cytoskeletal function. Nature 2003, 422: 775
781