Categories
Articles

ABBS 2008,40(05): Expression and characterization of two secreted His6-tagged endo-b-1,4-glucanases from the mollusc Ampullaria crossean in Pichia pastoris


Original Paper

Pdf
file on Synergy
OPEN

omments

Acta Biochim Biophys
Sin 2008, 40: 419-425

doi:10.1111/j.1745-7270.2008.00413.x

Expression and characterization of two
secreted His
6-tagged endo-b-1,4-glucanases from the mollusc Ampullaria
crossean
in Pichia pastoris

Rui Guo1, Ming Ding2, Siliang Zhang1, Genjun Xu2,3, and Fukun Zhao2,3*

1
State Key Laboratory of Bioreactor
Engineering, East China University of Science and Technology, Shanghai 200237,
China

2
Key Laboratory of
Proteomics, Institute of Biochemistry and Cell Biology, Shanghai Institutes for
Biological Sciences, Chinese Academy of Sciences, Shanghai 20031, China

3
College of Life Science,
Zhejiang Sci-Tech University, Hangzhou 310018, China

Received: December
23, 2007       

Accepted: March 6,
2008

This work was
supported by the grants from the National Natural Science Foundation of China (No.
30370336), the Major State Basic Research Development Program of China (No.
2003CB716006 and No. 2004CB719702), and the Creation Foundation from Shanghai
Institutes for Biological Sciences

Abbreviations:
CMC-Na, carboxylmethyl cellulose sodium salt; GHF, glycoside hydrolase family;
PCR, polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide
gel electrophoresis.

*Corresponding
author: Tel, 86-21-54921155; Fax, 86-21-54921011; E-mail, [email protected]

Two endo-b-1,4-glucanase cDNAs, eg27I and eg27II,
from the mollusc Ampullaria crossean were expressed in Pichia
pastoris
cells. The secreted His
6-tagged proteins were purified in a single
chromatography step. The purified recombinant EG27I and EG27II showed enzymatic
activity on carboxylmethyl cellulose sodium salt at 15.31 U/mg and 12.40 U/mg,
respectively. The optimum pH levels of the recombinant EG27I and EG27II were
5.5 and 5.5-6.0, respectively, and the optimum temperatures were 50 ºC and 50
ºC-55 ºC, respectively. The pH stability study revealed that both EG27I and
EG27II showed their highest stability at pH 8.0. Analysis of their
thermostability indicated that both EG27I and EG27II were relatively stable up
to 40 ºC. Site-directed mutagenesis of Asp43 and Asp153 of both EG27I and
EG27II showed that the two Asp residues are critical for the enzymatic
activity.

Keywords        cellulase; endoglucanase; EG27I; EG27II; Ampullaria
crossean
; Pichia pastoris

Cellulose, a polysaccharide of b-1,4-linked glucose residues,
is the primary product of photosynthesis in terrestrial environments, and the
most abundant renewable bioresource produced in the biosphere. The annual net
yield is approximately 1
´1012 tons [1,2]. The growing concerns about the shortage of fossil
fuels, the emission of greenhouse gasses, and air pollution by incomplete
combustion of fossil fuels have made cellulose hydrolysis a subject of
scientific research and industrial interest for many years. The biological
hydrolysis of cellulose to glucose occurs by the action of enzymes known as
“cellulases”, including exo-
b-1,4-glucanases, endo-b-1,4-glucanases, and b-1,4-glucosidase
[3].

Cellulases are widely distributed in nature. It is now clear that
not only fungi, bacteria, plants, and protists, but also a wide range of
invertebrate animals, can produce cellulase endogenously, including insects,
crustaceans, annelids, molluscs, and nematodes [4,5]. Although the number of
animal cellulase genes is growing, the recombinant expression of animal cellulases
is difficult. The only successful report to date is the endo-
b-1,4-glucanase
of the mulberry longicorn beetle [glycoside hydrolase family (GHF)45] that was
expressed using baculovirus-mediated insect-cultured cells [6-8]. The cellulase
genes of termites and the pine wood nematode were expressed in Escherichia
coli
, but the enzymatic properties of the recombinant protein were not
described [9-11].

Ampullaria crossean are tropical and
subtropical freshwater snails. Cellulase activity including endoglucanase,
exoglucanase, and xylanase has been detected in the stomach juice of A.
crossean
[12,13]. A battery of cellulase genes belonging to GHF10
(AAP31839), GHF9 (ABD24274-ABD24281), and GHF45 (EF471315-EF471316) have been
found in A. crossean [14,15]. These cellulases make the cellulose
degradation in A. crossean efficient. A. crossean can produce an
intact cellulose hydrolysis system, and it is a good organism for studying the
interaction of different cellulases in cellulose hydrolysis.

Here we constructed a new recombinant strain of Pichia pastoris
that secreted recombinant EG27, and expressed the protein. The purified enzyme
for the properties assays can be acquired conveniently through one-step metal
chelating affinity chromatography. To our knowledge, this is the first case of
successful expression of animal cellulases in P. pastoris. This is a
good beginning for studying the interaction of cellulase during the course of
cellulose hydrolysis.

Materials and Methods

Strains, plasmids, and reagents

Pichia pastoris strain GS115 and vector
pPIC9K were obtained from Invitrogen (Carlsbad, USA). Restriction enzymes, Pyrobest
DNA polymerase, and T4 DNA ligase were purchased from TaKaRa (Dalian,
China). Media components were from Difco (Detroit, USA). RDB, YPD, BMGY, and
BMMY were all prepared following the Invitrogen expression manuals. Chelating
Sepharose fast flow was purchased from GE Healthcare (Piscataway, USA).
Carboxylmethyl cellulose sodium salt (CMC-Na) was obtained from Sigma (St.
Louis, USA). All other analytical grade reagents were obtained from commercial
sources.

Construction of expression vector

Plasmid pMD18-T containing the eg27I and eg27II genes
(GenBank accession No. EF471315 and No. EF471316, respectively) from DH12S was
constructed as previously reported [15]. The cDNA fragments encoding the mature
eg27I and eg27II (lacking the native signal peptide sequence)
were amplified using the specific primers: EG27I-F, 5‘-GCGAATTCCATCATCATCATCATCAT­GCA­CAGTTGTGTCAGCCAGAC-3;
EG27I-R, 5‘-ATAA­GA­ATGCGGCCGCTTAGCCCGAATTGTGGCATT-3; E­G27II-F,
5-CGGAATTCCATCATCATCATCAT­CATG­CACAGTTGTGTCAACCAGAC3;
and EG27II-R, 5-ATAAGAATGCGGCCGCT­TAGTCCGAAT­TGTGG­CAT­T-3.
In forward primers, the EcoRI sites (underlined) were introduced, and
His
6 tag sequences were created downstream of the restriction site. In
reverse primers, NotI restriction sites (underlined) were added,
upstream of the termination TAA codon. A 50 ml polymerase chain reaction (PCR)
mixture contained 1.25 U Pyrobest DNA polymerase, 5 ml of 10
´Pyrobest buffer, 2.5 mM of each dNTP, 20 pmol of each primer, and 1
ml pMD18T-eg27I or pMD18T-eg27II plasmid DNA. The amplification
conditions were as follows: 94 ºC for 5 min; 94 ºC for 45 s, 56 ºC for 45 s, 72
ºC for 1.5 min (30 cycles); and 72 ºC for 10 min. The PCR products were
gel-purified and digested with the restriction enzymes EcoRI/NotI.
After digestion, the fragments were ligated at the EcoRI/NotI
site of pPIC9K to yield the vector pPIC9K-eg27I or pPIC9K-eg27II.
The expression plasmid was transformed into E. coli DH12S, then
amplified and purified. The insert products were sequenced on an ABI3730
nucleotide sequencer (ABI, Foster City, USA).

Transformation of P. pastoris and expression

The plasmid DNA of pPIC9K-eg27I, pPIC9K-eg27II, and
pPIC9K (used as a control plasmid) was linearized with the restriction enzyme SacI
and integrated into P. pastoris strain GS115 chromosomal DNA by
electroporation (Bio-Rad, Hercules, USA). The His
+ transformants were then selected on RDB (1 M sorbitol, 2% dextrose,
1.34% YNB, 4
´105% biotin, 5´103% amino acids without
histidine, and 2% agar) plates. Colonies of GS115/pPIC9K-eg27I and
GS115/pPIC9K-eg27II cultured on YPD-geneticin plates were inoculated
into 200 ml BMGY medium [1% yeast extract, 2% peptone, 1.34% YNB, 4
´105% biotin, 100 mM potassium phosphate (pH 6.0), and 1% glycerol] and
grown at 30 ºC in a shaker incubator for approximately 18 h. When A
600 reached 6, the cells were harvested by centrifuging for 5 min at
3000 g. The cell pellets were resuspended in 1000 ml BMMY medium (BMGY
medium with 0.5% methanol instead of 1% glycerol) and cultured for 72 h at 30
ºC. To maintain induction, methanol was added every 24 h to keep the final
methanol concentration at 0.75%. At the end of incubation, the cultures were
centrifuged at 6000 g for 15 min. Phenyl­methyl­sulfonyl fluoride
solution was added in the supernatant to a final concentration of 1 mM. The
expressed products were analyzed by 15% sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE).

Purification of recombinant EG27I and EG27II 

Chelating Sepharose fast flow saturated with Ni2+ was equilibrated with 20 mM Tris-HCl buffer (pH 8.0) containing 500
mM NaCl. The culture supernatant containing endoglucanase was adjusted to pH 8.0
with 1 M Tris. The equilibrated resin was mixed with the supernatant on a
shaker incubator for 4 h at 4 ºC. Once bound with protein, the resin was
allowed to settle to the bottom of the container, and the supernatant was
poured off. The resin was then packed into a column. The column with resin was
washed with 10 column volumes of buffer A [20 mM Tris-HCl (pH 8.0), 500 mM
NaCl, 10 mM imidazole]. The N-terminus His
6-tagged proteins were eluted with six column volumes of buffer C [20
mM Tris-HCl (pH 7.9), 500 mM NaCl, 200 mM imidazole, and 0.5 mM phenylmethyl­sulfonyl
fluoride] at a flow rate of 1.0 ml/min. For further assays, the purified
protein was concentrated using a Microsep
centrifugal
device (Pall Life Sciences, Ann Arbor, USA).

 

SDSPAGE and determination of protein
concentration

SDS-PAGE analysis was carried out using 15% gels according to the
method of Laemmli [16]. The bands were visualized using silver staining. The
protein concentration was determined by the reported method using bovine serum
albumin as a standard [17].

Enzyme assays

The recombinant enzymes were assayed for the hydrolysis of CMC-Na.
For the CMCase assay, the enzyme solution was added to 200 ml of 1% CMC-Na in
0.1 M sodium acetate buffer (pH 4.8). The reaction mixture was incubated at 50
ºC for 30 min, and the reaction terminated by adding 0.5 ml dinitrosalicylic
acid reagent. The mixture was placed in a boiling water bath for 6 min and
rapidly cooled to room temperature, followed by the addition of 0.5 ml water.
The absorbance of the mixture was subsequently measured at 540 nm. One unit of
enzyme activity was defined as the amount of enzyme producing 1 mmol of
reducing sugar in glucose equivalents per minute [18].

The temperature optimum was investigated by running the standard
assay at 20, 30, 40, 50, 60, 70, and 80 ºC. Temperature stability was assessed
by incubating the enzyme at 20, 30, 40, 50, 60, 70, and 80 ºC for 24 h, and the
residual activity was measured using the standard assay.

The pH optimum was measured by running the standard assay at
different pH values. The buffers used were KCl-HCl (pH 1.0–2.0), citrate (pH
3.0), acetate (pH 4.0–5.0), phosphate (pH 6.0–7.0), Tris-HCl (pH 8.0–9.0), Na
2CO3-NaHCO3 (pH 10.0), Na2HPO4-NaOH (pH 11.0 was measured by the standard assay.

Sitedirected mutagenesis

The site-directed mutagenesis of the eg27 gene was generated
by strand overlap PCR as described [19] using Pyrobest DNA polymerase.
For each mutation, three PCR reactions were required. Briefly, a DNA fragment
was amplified using a forward primer and the antisense mutant primer, and the
overlapping fragment was amplified using the sense mutant primer and a
downstream reverse primer. The wild-type pPIC9K-eg27I and pPIC9K-eg27II
were used as templates. Both fragments were gel-purified, mixed, and
re-amplified using the forward and reverse primers with Pyrobest DNA
polymerase. The product was digested by restriction enzymes EcoRI and NotI,
gel-purified, and ligated to pPIC9K, digested by the same restriction enzymes.
The sequences of the mutants were verified by DNA sequencing. The
electroporation of the mutant plasmids into P. pastoris GS115,
expression of the mutants, and purification of the mutant proteins were all
carried out according to the instruments described above.

Results

Expression of EG27 in P. pastoris

The pPIC9K shuttle vector system was designed to permit secretion of
the cloned target gene. Recombinant EG27I and EG27II were produced using the P.
pastoris
strain GS115 and detected in the culture supernatant using 15%
SDS-PAGE. No protein of the same molecular weight was found in control cultures
of P. pastoris GS115 transformed with empty vector (Fig. 1). The
presence of the His
6-tag fusion made the purification
of EG27I and EG27II convenient. The purified recombinant EG27I and EG27II are
shown in Fig. 2.

Enzymatic properties of recombinant EG27I and EG27II

The yields of the recombinant EG27I and EG27II were 0.7 mg/L and 1.8
mg/L, respectively. This low yield for the recombinant enzymes could be
attributed to the differences in codon usage. The recombinant enzymes could be
acquired through metal chelating affinity chromatography. The catalytic
activity of the purified recombinant EG27I and EG27II enzymes on CMC-Na were
15.31 U/mg and 12.40 U/mg, respectively.

The optimum pH of the recombinant EG27I and EG27II were 5.5 and
5.5-6.0, respectively (Fig. 3). The activities declined rapidly on both
acid and alkaline sides. At pH 4.0, EG27I was inactive, whereas EG27II retained
20% of its maximum activity. At pH 8.0, both EG27I and EG27II were inactive.
The optimum temperatures for the activity of the recombinant EG27I and EG27II
were 50 ºC and 50 ºC-55 ºC, respectively (Fig. 4). EG27II activity had a
broader optimum activity temperature range; it retained 93% of its maximum
activity at 60 ºC.

The pH stability study (Fig. 5) revealed that both EG27I and
EG27II showed their highest stability at pH 8.0. EG27II was more stable than
EG27I in the pH value range 3.0-12.0. EG27II retained 47% and 68% of its
maximum activity at pH 3.0 and 12.0, respectively, after incubation at 30 ºC
for 24 h. The thermostability assay (Fig. 6) revealed that both EG27I
and EG27II were relatively stable up to 40 ºC, although their stability decreased
rapidly at higher temperatures. At 60 ºC, both enzymes retained approximately
10% of their maximum activity.

Enzymatic properties of site-directed mutagenesis

Database searches of the amino acid sequence in our previous work
indicated that EG27I and EG27II belong to GHF45 family. But the sequence
identity of EG27I and EG27II to other cellulases from the GHF45 family is low.
Only two aspartic acids conserved among all GHF45 enzymes were identified in
the amino acid sequences of EG27I and EG27II (Fig. 7). Site-directed
mutagenesis of the catalytic residues Asp43 and Asp153 in EG27I and EG27II were
used to confirm their significance in catalysis. The two aspartates (Asp43 and
Asp153) were mutated to asparagines. The mutant proteins (EG27I
D43N, EG27IID43N, EG27ID153N, and EG27IID153N) were
expressed and purified. The catalytic activity was measured by the analysis of
reducing sugar within the limits of accuracy of the assay. It was found that
mutation of either Asp43 or Asp153 caused total inactivation of the enzyme
(data not shown).

Discussion

It was shown that a wide range of invertebrate animals could produce
cellulase endogenously, and many cellulase genes were cloned from these animals
[4,5,20,21]. However, the heterologous expression of animal cellulases in
microorganisms is difficult; this could be attributed to the differences in
codon usage and post-transcriptional modifications. Cellulase genes from the
pine wood nematode and termite were expressed in E. coli [9-11], but the
enzymatic activity of the recombinant protein was not described. The
endoglucanase genes from longicorn beetle were expressed and the purified
recombinant EGases were assayed for some enzymatic properties, but these genes
were expressed in baculovirus-mediated insect-cultured cells. Here the two eg27
cDNAs were expressed in P. pastoris cells as an active form. Although
the yield of the recombinant EG27 was low, the secreted His
6-tagged EG27 could be purified in a single chromatography step.

The recombinant EG27I and EG27II proteins were detected by SDS-PAGE.
The molecular mass of the recombinant EG27I was greater than that of EG27II.
This anomalously slow migration in SDS-PAGE is most likely the result of
insufficient SDS binding and a concomitant low negative net charge [22]. The
molecular mass of purified recombinant EG27II was approximately 27 kDa; this is
similar to the EG27 derived from the stomach juice of A. crossean (Fig.
2
). However, the molecular mass of both the recombinant enzymes and the
enzyme from the stomach juice of A. crossean were larger than the
deduced molecular mass of 20 kDa. This inconsistency might be due to the
difference of the mobility on SDS-PAGE between the cellulase protein and the
standard proteins of the molecular weight markers used in the experiment [23].

The enzymatic properties of the recombinant EG27I and EG27II were
similar to those previously reported for the enzyme from the stomach juice of A.
crossean
. The optimum pH of the enzyme EG27 from the stomach juice of A.
crossean
was 4.4-4.8. EG27 and the recombinant EG27I and EG27II have their
optimal activity under weak acidic conditions. The enzyme EG27 has a broad
stability at a pH range of 3.0-11.0; the pH and temperature stability of the
recombinant EG27s was lower. This could be attributable to the heterogenous
expression in P. pastoris. Comparing the properties of the two
recombinant EG27s, it was found that EG27II had greater stability than EG27I,
and that the optimum pH and temperature ranges of EG27II were broader than
those of EG27I. Such phenomena have been observed in other animal cellulases,
namely two endo-b-1,4-glucanases of GHF45 from the mulberry longicorn beetle, Apriona
germari
[6,7]. A synergism between these cellulases could be necessary for
the efficient hydrolysis of cellulose.

The amino acid sequences of EG27I and EG27II had low identity to
other endoglucanases from GHF45 [15]. They showed 41.3%–42.9% identity to
endoglucanases from mollusc Mytilus edulis [24], less than 30% identity
to other animal endoglucanases, and 13.3%–18.4% identity to fungi Humicola
insolens
[6-11]. But it was found that two catalytic residues (Asp43 and
Asp153) were conserved among these GHF45 enzymes. Fig. 7 shows the
details of the two conserved aspartates. The roles of these two catalytic
aspartates in fungi H. insolens were confirmed by structure analysis
[25,26]. As EG27I and EG27II showed low identity to H. insolens,
site-directed mutagenesis of the two conserved aspartates was used in this
study to confirm their catalysis significance in EG27I and EG27II. The P.
pastoris
system was used for the expression of four mutant proteins (EG27I
D43N, EG27IID43N, EG27ID153N,
and EG27II
D153N). The recombinant mutated protein did not have catalytic activity
within the limits of accuracy of the assay. It was shown that Asp43 and Asp153
were critical for enzymatic activity in EG27I and EG27II.

In summary, we established a production system for EG27I and EG27II
in P. pastoris that retains the natural activity and structure of the
enzyme from the stomach juice of A. crossean. This system can be used
for some catalytic residue analyses. Animal cellulase provides a new field for
cellulase research. Animals possess several cellulases endogenously that belong
to more than one GHF, such as A. crossean [12-15] and A. germari [6-8].
Cellulose hydrolysis requires several cellulases working synergically. And
these cellulases can make the cellulose degradation efficiently. Expression of
endogenous cellulase genes in animals can help us to understand the interaction
of different cellulases in cellulose hydrolysis. We look forward to the
application of this animal cellulolytic system in both industry and biomass
conversion.

References

1       Fan LT, Gharpuray MM, Lee YH.
Cellulose Hydrolysis. Berlin: Springer 1987

2       Percival Zhang YH, Himmel
ME, Mielenz JR. Outlook for cellulase improvement: screening and selection
strategies. Biotechnol Adv 2006, 24: 452
481

3       Wilson DB, Irwin DC.
Genetics and properties of cellulases. Adv Biochem Eng Biotechnol 1999, 65: 1
21

4       Watanabe H, Tokuda G.
Animal cellulases. Cell Mol Life Sci 2001, 58: 1167
1178

5       Davison A, Blaxter M.
Ancient origin of glycosyl hydrolase family 9 cellulase genes. Mol Biol Evol
2005, 22: 1273
1284

6       Lee SJ, Kim SR, Yoon HJ,
Kim I, Lee KS, Je YH, Lee SM et al. cDNA cloning, expression, and
enzymatic activity of a cellulase from the mulberry longicorn beetle, Apriona
germari
. Comp Biochem Physiol B Biochem Mol Biol 2004, 139: 107
116

7      Lee SJ, Kim SR, Yoon HJ, Kim
I, Lee KS, Je YH, Lee SM et al. A novel cellulase gene from the mulberry
longicorn beetle, Apriona germari: gene structure, expression, and
enzymatic activity. Comp Biochem Physiol B Biochem Mol Biol 2005, 140: 551
560

8       Wei YD, Lee KS, Gui ZZ,
Yoon HJ, Kim I, Zhang GZ, Guo X et al. Molecular cloning, expression,
and enzymatic activity of a novel endogenous cellulase from the mulberry
longicorn beetle, Apriona germari. Comp Biochem Physiol B Biochem Mol
Biol 2006, 145: 220
229

9       Kikuchi T, Jones JT, Aikawa
T, Kosaka H, Ogura N. A family of glycosyl hydrolase family 45 cellulase from
the pine wood nematode Bursaphelenchus xylophilus. FEBS Lett 2004, 572:
201
205

10     Ni J, Takehara M, Watanabe H.
Heterologous overexpression of a mutant termite cellulase gene in Escherichia
coli
by DNA shuffling of four orthologous parental cDNAs. Biosci Biotechnol
Biochem 2005, 69: 1711
1720

11     Khademi S, Guarino LA,
Watanabe H, Tokuda G, Meyer EF. Structure of an endoglucanase from termite, Nasutitermes
takasagoensis
. Acta Crystallogr D Biol Crystallogr 2002, 58: 653
659

12     Wang J, Ding M, Li YH, Chen
QX, Xu GJ, Zhao FK. A monovalent anion affected multi-functional cellulase EGX
from the mollusc, Ampullaria crossean. Protein Expr Purif 2003, 31: 108
114

13     Li YH, Guo R, Yin QY, Ding
M, Zhang SL, Xu GJ, Zhao FK. Purification and characterization of two
endo-b-1,4-glucanases from mollusc, Ampullaria crossean. Acta Biochem
Biophys Sin 2005, 37: 702
708

14     Wang J, Ding M, Li YH, Chen
QX, Xu GJ, Zhao FK. Isolation of a multi-functional endogenous cellulase gene
from mollusc, Ampullaria crossean. Acta Biochim Biophys Sin 2003, 35:
941
946

15     Guo R, Ding M, Zhang SL, Xu
GJ, Zhao FK. Molecular cloning and characterization of two novel cellulase
genes from the mollusc Ampullaria crossean. J Comp Physiol [B] 2008,
178: 209
215

16     Laemmli UK. Cleavage of
structural proteins during the assembly of the head of bacteriophage T4. Nature
1970, 227: 680
685

17     Lowry OH, Rosebrough NJ,
Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol
Chem 1951, 193: 265
275

18     Wood TM, Bhat M. Methods for
measuring cellulase activities. Methods Enzymol 1988, 160: 87
112

19     Sambrook J, Russell DW. Molecular
Cloning: A Laboratory Manual. 3rd edn. Cold Spring Harbor Laboratory Press 2001

20     Suzuki K, Ojima T, Nishita
K. Purification and cDNA cloning of a cellulase from abalone Haliotis discus
hannai
. Eur J Biochem 2003, 270: 771
778

21     Nishida Y, Suzuki K, Kumagai
Y, Tanaka H, Inoue A, Ojima T. Isolation and primary structure of a cellulase
from the Japanese sea urchin Strongylocentrotus nudus. Biochimie 2007,
89: 1002
1011

22     Werten MW, Wisselink WH,
Jansen-van den Bosch TJ, de Bruin EC, de Wolf FA. Secreted production of a
custom-designed, highly hydrophilic gelatin in Pichia pastoris. Protein
Eng 2001, 14: 447
454

23     Sugimura M, Watanabe H, Lo
N, Saito H. Purification, characterization, cDNA cloning and nucleotide
sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea
hilaris
. Eur J Biochem 2003, 270: 3455
3460

24     Xu B, Janson JC, Sellos D.
Cloning and sequencing of a molluscan endo-
b-1,4-glucanase gene
from the blue mussel, Mytilus edulis. Eur J Biochem 2001, 268: 3718
3727

25     Davies GJ, Dodson GG,
Hubbard RE, Tolley SP, Dauter Z, Wilson KS, Hjort C et al. Structure and
function of endoglucanase V. Nature 1993, 365: 362
364

26     Davies GJ, Tolley SP,
Henrissat B, Hjort C, Schulein M. Structures of oligosaccharide-bound forms of
the endoglucanase V from Humicola insolens at 1.9Å resolution.
Biochemistry 1995, 34: 16210
16220