Original Paper |
|
|||
|
Acta Biochim Biophys |
||||
|
doi:10.1111/j.1745-7270.2008.00417.x |
Stable high-level expression of
truncated human papillomavirus type 16 L1 protein in Drosophila
Schneider-2 cells
Jin Zheng1,
Xiaofeng Yang1,2,
Ying Sun1,
Baochang Lai1,
and Yili Wang1*
1 Key Laboratory of Biomedical Information
Engineering, Ministry of Education, Center of Vaccine Development, School of
Life Science and Technology, Xi抋n Jiaotong
University, Xi’an 710061, China
2 Department of Obstetrics and Gynecology, The
First Affiliated Hospital, Medical School of Xi抋n Jiaotong
University, Xi’an 710061, China
Received: December
19, 2007
Accepted: March 14,
2008
*Corresponding
author: Tel/Fax, 86-29-82655499; E-mail, [email protected]
To improve
the existing human papillomavirus type 16 (HPV16) virus-like particle (VLP)
preparation, the Drosophila inducible/secreted expression system, a
highly efficient, economical method, was used to produce HPV16 VLPs. Drosophila
Schneider-2 cells were cotransfected with pMT/BiP/V5-His expression vector
containing the target gene encoding HPV16L1 protein without nucleus
localization sequence and the selection vector pCoHygro plasmids at the ratio
of 4:1. The stabled hygromycin-resistant cell line was obtained 1 month later,
and the protein expression was induced by copper sulfate. The molecular mass of
expressed HPV16L1 protein was 66 kDa, as revealed by SDS-PAGE, and confirmed by
Western blot analysis. The yield of HPV16L1 protein was 0.554 mg per 1´107 cells. The
characteristics of HPV16L1 protein were further analyzed by mouse erythrocyte
hemagglutination assay, hemagglutination inhibition assay, and transmission
electron microscopy. Results showed that the truncated protein was as
biologically active as natural HPVL1 protein, inducing murine erythrocyte
agglutination and VLP formation. These findings indicate that the Drosophila
inducible/secreted expression system is promising as a convenient and
economical method for the preparation of HPV16 VLP vaccine.
Keywords HPV16L1; DS-2 cell; VLPs; Drosophila
High-risk human papillomavirus (HPV) infection is the major
initiator of human cervical cancer, and the list of malignancies caused by or
associated with HPV is still growing. HPV has been detected in carcinomas of
larynx, esophagus, oral cavity, nasal sinus, skin, bladder, and lung [1].
The major breakthrough in the development of prophylactic HPV
vaccine was the finding that HPVL1 protein could self-assemble in virus-like
particles (VLPs) in the absence of all other viral proteins when expressed through
recombinant baculovirus-infected insect cells. Most importantly, these VLPs
have a diameter of approximately 50 nm, like authentic HPV virions, and retain
their natural conformation and biological activity [2–4]. Our previous studies
have also shown that HPVL1 protein could be expressed in various expression
systems such as in baculovirus-infected insect cells, Shigella flexneri,
yeast, plant cells, and mammalian cells [5–7], and the HPV vaccines
expressed in insect and/or yeast systems are commercially available. Although
VLP-based HPV vaccine is one of the greatest breakthroughs in cancer
prevention, the wide application of this vaccine in the population is hampered
by its high price. So an affordable vaccine for widespread use in developing
countries might be the final answer. The second- and third-generation HPV
prophylactic vaccines that focus on this issue are in their early development
[8].
In the present study, we describe the production of HPV type 16 L1
(HPV16L1) protein in Drosophila Schneider-2 (DS-2) cells that has been
proven to be an efficient experimental system for high-level protein expression
[9–11].
Our results show that this system is promising for the expression of the L1
gene of HPV.
Materials and Methods
Materials
Restriction enzymes were purchased from Promega (Madison, USA). The
vector pMT/BiP/V5-HisA was purchased from Invitrogen (Carlsbad, USA). DS-2
cells were from the laboratory of Dr. Bernard A. Fox (Biochemistry and
Molecular Biology, Oregon Health and Science University, Portland, usa). Grace’s insect cell culture
medium was from Invitrogen. Mouse anti-HPV16L1 and horseradish
peroxidase-labeled goat anti-mouse antibodies were from NeoMarkers (Fremont,
USA) and DaKo (Carpinteria, USA), respectively. Polyclonal antibodies against
L1 VLPs of wild-type HPV16 (the VLPs were expressed in a baculovirus-infected
insect system and purified [5]) were raised from immunized rabbits in our own
laboratory.
Construction of recombinant
plasmid pMT/BiP/V5-HisA-HPV16L1
Plasmid constructions were carried out by standard cloning
techniques. The HPV16L1 gene (GenBank accession No. Af125673) without nucleus
localization sequence was obtained from plasmid pGEM-T-HPV16 [5] by polymerase
chain reaction (PCR). The forward primer was 5‘-TCTCCATGGATGTCTCTTTGGCTG-3‘
including the NcoI restriction site. The reverse primer was 5‘-CCGCTCGAGTTATTGTAGTAAAAATTTGCG-3‘
including the XhoI restriction site. The 1413 bp DNA fragment
generated was recovered and digested with NcoI/XhoI, then inserted
into the pMT/BiP/V5-HisA vector, resulting in the plasmid
pMT/BiP/V5-HisA-HPV16L1, subsequently confirmed by using NcoI/XhoI
restriction cleavage and sequencing.
Cell culture
DS-2 cells were maintained at 27 ºC in Grace’s insect cell culture
medium supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml
penicillin, and 100 mg/ml streptomycin.
Transfection
The transfection was carried out in exponentially growing DS-2
cells. The cells were washed with Grace’s medium (without fetal bovine serum or
antibiotics) twice and the cell number was adjusted to 2.5´107 cells/ml before transfection. Then 20 mg
pMT/BiP/V5-HisA-HPV16L1 and 5 mg pCoHygro plasmids were mixed and added to 400 ml DS-2 cell
suspension (1´107 cells).
The mixtures were then electroporated under 350 V and a pulse time of 0.8 ms.
Ten minutes after electroporation, the transfected cells were transferred to
culture dishes containing 2 ml Grace’s complete medium. The medium was replaced
with selective medium (fresh Grace’s complete medium containing 300 mg/ml hygromycin)
the following day. The selective medium was refreshed every 5 d, and stably
transfected cell populations were passaged when the cell number reached 1´107 cells/ml.
Expression of HPV16L1 protein
For analysis of HPV16L1 expression, hygromycin-resistant DS-2 cells
were seeded in Grace’s complete medium at a density of 2´106 cells/ml and cultured for 34 d at 27 ºC. The
expression of HPV16L1 was induced by adding fresh Grace’s medium containing 1
mM CuSO4 without serum for 48 h. To identify the HPV16L1 protein expression,
the supernatant of hygromycin-resistant DS-2 cells and the cell lysate were
analyzed by SDS-PAGE and Western blot analysis. Briefly, proteins were resolved
by 12%
SDS-PAGE then transferred
to a polyvinylidene difluoride membrane. The membrane was blocked by incubation
for 1 h at room temperature in 5% non-fat dry milk and 1% bovine serum albumin
in Tris-buffered saline (pH 7.5), sequentially, then incubated with mouse
anti-HPV16L1 monoclonal antibodies (NeoMarkers) at 1:1000. Horseradish
peroxidase-conjugated goat anti-mouse immunoglobulin G (DaKo) was used as the
secondary antibody, and diaminobenzidine was used for color development.
Electron microscopy
For analysis of VLP assembly by transmission electron microscopy,
the supernatant of hygromycin-resistant DS-2 cells was dropped onto
carbon-coated copper grids, and negatively stained with phosphotungstic acid.
Specimens were then observed under an H-600 transmission electron microscope
(Hitachi, Japan). The supernatant of normal DS-2 cells were used as a control.
Assay for biological
characterization of HPV16L1 protein
Authentic HPV VLPs cause hemagglutination of murine erythrocytes,
which can be inhibited by neutralizing antibodies against VLPs [12]. In order
to test whether HPV16 VLPs assembled with truncated L1 protein expressed by
DS-2 cells retain the function of hemagglutination of murine erythrocytes,
hemagglutination assay (HA) and hemagglutination inhibition assay (HAI) were
carried out as described [5]. For HA, erythrocytes were isolated from C57BL/6
mice heparinized blood by centrifugation (1000 g for 5 min at 4 ºC). The
erythrocytes were then washed and resuspended at 1% (v/v)
in phosphate-buffered saline (PBS) containing 1 mg/ml bovine serum albumin. The
supernatant of hygromycin-resistant DS-2 cells was serially diluted 2-fold in
PBS, then 50 ml was transferred to 96-well plates, and mixed with an equal volume
of 1% (V/V) suspension of erythrocytes in PBS. The plate was
visualized and photographed after 3 h incubation at 4 ºC. For HAI, the
polyclonal antibodies to HPV16L1 were diluted at different ratios (1:500,
1:1000, 1:2000, 1:4000, and 1:8000), then incubated with the supernatant of
hygromycin-resistant DS-2 cells at room temperature for 1 h before adding the
erythrocyte suspension. The subsequent procedure was the same as for HA.
Yield of truncated HPV16L1
proteins
The supernatant of induced hygromycin-resistant DS-2 cells was
analyzed by SDS-PAGE and stained with Coomassie Brilliant Blue. Then the purity
of the truncated HPVL1 protein was estimated by a lamina scanner. The quantity
of total protein in the supernatant of induced hygromycin-resistant DS-2 cells
was measured by a BCA Protein Assay Kit (Pierce, Rockford, USA).
Results
Identification of
pMT/BiP/V5-HisA-HPV16L1 constructs
The HPV16L1 gene fragment from PCR products and the plasmid
pMT/BiP/V5-HisA were digested with NcoI/XhoI. The HPV16L1 gene fragment
was inserted into pMT/BiP/V5-HisA and the recombinant pMT/BiP/V5-HisA-HPV16L1
was obtained. The construct was confirmed by NcoI/XhoI digestion,
PCR screening, and sequencing. The resulting DNA fragment of NcoI/XhoI
digestion and PCR was approximately 1400 bp in length (data not shown),
consistent with that of the truncated HPV16L1 gene sequence (1413 bp). The full
length of the wild-type HPV16L1 gene is 1515 bp. The sequence coding for NLS of
L1 protein was 102 bp ( GCAGGATTGAAGGCCAAACCAAAATTTACATTAGGAAAACGAAAAGCTACACCCACCACCTCATCTACCTCTACAACTGCTAAACGCAAAAAACGTAAGCTG
) and deleted when the truncated HPV16L1 gene was cloned (Fig. 1).
Generation of stably
transfected DS-2 cell lines
In order to obtain the stably transfected DS-2 cell lines, DS-2
cells were cotransfected with pMT/BiP/V5-HisA-HPV16L1 and pCoHygro plasmids at
the ratio of 4:1. Cotransfected cells were grown after 2 weeks of selection,
and the cell number reached 1´107/ml after 1 month. Compared with normal control cells, the
transfected cell became rounded and swollen with many filamentous cilia on the
cell surface (Fig. 2).
Expression and identification
of HPV16L1 protein
After 3 d of induction, DS-2 cells and supernatant were collected
separately for analysis by SDS-PAGE and Western blot. A distinct band of 66 kDa
from the supernatant was detected compared with the control samples in the
SDS-PAGE analysis [Fig. 3(A)]. Western blot analysis from the
supernatant also showed a unique band of 66 kDa, but two bands were found in
the sample of cell lysate, one was 66 kDa and the other approximately 45 kDa.
Moreover, the band of 66 kDa was weaker than that of 45 kDa [Fig. 3(B)].
The calculated molecular mass of HPV16L1 protein was 58 kDa and that of the
truncated HPV16L1 protein expressed here was approximately 45 kDa. It was
postulated that the secreted form of the HPV16L1 protein had undergone some
post-translational modifications so that the molecular mass was increased from
45 kDa to 66 kDa.
Self-assembly of HPV16 VLPs in
vitro by expressed L1 protein
Morphologically, the self-assembled VLPs from truncated HPV16L1
protein were confirmed by electron microscopy. As shown in Fig. 4, the
hollow spherical structures were approximately 50 nm in diameter, identical to
the dimensions of HPV VLPs reported previously [13,14].
Biological activity of HPV16L1
protein
In HA assay, the supernatant of transfected DS-2 cell culture under
induction of Cu++ showed HA activity, but the supernatant of
normal DS-2 cell culture under the same conditions did not [Fig. 5(A)].
In HAI, the HA activity from L1 VLP was abolished by the antibodies against L1
VLPs of wild-type HPV16 at the dilution ratios of 1:500 and 1:1000 [Fig.
5(B)]. This was an indication that the VLPs from truncated HPV16L1 protein
expressed by DS-2 cells have the biological activity of agglutinating murine
erythrocytes.
Yield of truncated HPV16L1
protein
The purity of truncated L1 protein in the supernatant was 70.6% (Fig.
3), and the amount of the protein end product was 0.788 mg/ml in 5 ml
supernatant obtained from 5´107 productive DS-2 cells. Compared with the conventional Spodoptera
frugiperda (Sf-9) strain as host cell in the baculovirus-infected insect
system, the yield of the protein end product of DS-2 cells at the same volume
of culture was significantly higher (Table 1).
Discussion
In this report, we have shown the stable high-level expression of
HPV16L1 protein in DS-2 cells. This system is especially well-suited to expressing
secreted proteins (soluble hIL-5 receptors) [15] and enzymes (dopamine b-hydroxylase)
[16]. DS-2 cells are cost-effective and easy to handle because they can be
easily grown at high densities in a serum-free medium at room temperature under
normal air atmosphere, and are highly inducible by Cu++.
Proteins expressed in DS-2 cells can be post-translationally processed, such as
glycosylation [17] and amidation [18], similar to that in mammalian cells. In
particular, a unique feature of DS-2 cells is the possibility of integrating up
to 1000 copies of an expression cassette in a single transfection-selection
event [19]. The secreted form of product avoids tedious purification processes.
Two advantages of the construct make the system attractive for the
expression of conformation-dependent proteins such as L1 VLP of HPVs. One is
the protein secretion machinery of the system per se, as mentioned
before, and the other is the deletion of nuclear localization signals (NLS) of
the L1 coding fragment. It is well known that the NLS of L1 protein on the
C-terminal leads the protein to anchor to the nucleus after synthesis in the
cytoplasm [20]. From the view of bioengineering, the deletion of NLS might
facilitate the secretion of the resultant product and the final yield. Our
previous study showed that the amount of truncated L1 protein without NLS
expressed in the cytoplasm of Sf-9 cells in a baculovirus-infected insect
system was 2.5-fold higher than the wild-type HPV16L1 protein with NLS (data
not shown). Under the control of secretion machinery, the product could be
secreted out of the host cells in the DS-2 cell system instead of accumulating
in the cytoplasm, as in Sf-9 cells. It should be noted that the sequences at
the C-terminal contribute to L1 VLP formation. Although the full length of the
NLS is not necessary to facilitate VLP assembly, it must be kept in mind that
the extent of integrity of C-terminal sequences affects the efficacy of VLP
assembly and the stability of the final product [21–23]. In the present study,
although up to 34 residues at the C-terminal were deleted, the results of
antigenicity, morphology, and conformation-dependent bioactivity (monitored by western blot analysis, transmission
electron microscope, HA, and HAI) were not affected significantly. The study of
the balance of the yields of end product and the efficacy and stability of VLPs
is still going on.
We have successfully expressed L1 VLPs of wild-type HPV16 in Sf-9
insect cells previously [5]. Compared with the L1 protein expressed in DS-2
cells, neither our results, nor those of other researchers, showed that the
quantity of HPV16L1 protein was satisfactory. The level of HPV16L1 protein
expressed in Sf-9 cells seems higher at first glance at the single cell level (0.554
mg/107 DS-2 cells versus 0.924 mg/107 Sf-9
cells), but when the cell density under the optimal growth status was taken
into account (2´107 cells/ml
in DS-2 cells versus 5´106 cell/ml in Sf-9 cells), the yield of end product protein was
dramatically changed from 0.017 mg/mg wet cell pellet in Sf-9 cells to
0.038mg/mg wet cell pellet in DS-2 cells (Table 1). Moreover, the
secreted product in supernatant is incomparably superior to that accumulated in
the cytoplasm in terms of final yields through complex purification procedures,
and the DS-2 cells as hosts clearly have their advantages.
In conclusion, the DS-2 cell expression system is convenient, less
expensive, and highly efficient. Hopefully, the establishment of the DS-2 cell
expression system for L1 protein without NLS will have potential in the
large-scale preparation of VLP-based HPV vaccine.
References
1 McCance DJ. Human papillomaviruses and
cervical cancer. J Med Microbiology 1998, 47: 371–373
2 Baker TS, Newcomb WW, Olson NH, Cowsert LM, Olson
C, Brown JC. Structures of bovine and human papillomaviruses. Analysis by
cryoelectron microscopy and three-dimensional image reconstruction. Biophys J
1991, 60: 1445–1456
3 Hagensee ME, Yaegashi N, Galloway DA.
Self-assembly of human papillomavirus type 1 capsids by expression of the L1
protein alone or by coexpression of the L1 and L2 capsid proteins. J Virol
1993, 67: 315–322
4 Le Cann P, Coursaget P, Iochmann S, Touze A.
Self-assembly of human papillomavirus type 16 capsids by expression of the L1
protein in insect cells. FEMS Microbiol Lett 1994, 117: 269–274
5 Zheng J, Ma J, Yang XF, Liu HL, Cheng HW, Si
LS, Wang YL. Highly efficient and economical baculovirus expression system for
preparing human papillomavirus type 16 virus-like particle. Acta Biochim
Biophys Sin 2004, 36: 548–552
6 Yang XF, Qu XZ, Wang K, Zheng J, Si LS, Dong
XP, Wang YL. Construction of prophylactic human papillomavirus type 16 L1
capsid protein vaccine delivered by live attenuated Shigella flexneri
strain sh42. Acta Biochim Biophys Sin 2005, 37: 743–750
7 Liu HL, Li WS, Lei T, Zheng J, Zhang Z, Yan
XF, Wang ZZ et al. Expression of human papillomavirus type 16 L1
proteins in transgenic tobacco plants. Acta Biochim Biophys Sin 2005, 37: 153–158
8 Twombly R. U.S. girls to receive HPV vaccine
but picture unclear on potential worldwide use, acceptance. J Natl Cancer Inst
2006, 98: 1030–1032
9 Kirkpatrick RB, Shatzman A. Drosophila
S2 system for heterologous gene expression. In: Fernandez JM, Hoeffler JP, eds.
Gene expression systems: Drosophila
S2 system for heterologous gene expression. San Diego: Academic Press, 1999
10 Khandekar SS, Mayer RJ, Cusimano DM, Katchur
SR, Appelbaum ER. Expression and purification of stable 33-kDa soluble human
CD23 using the Drosophila S2 expression system. Protein Expr Purif 2001,
22: 330–336
11 Dem L, Wolf H, Wagner R. High level expression
of hepatitis B virus surface antigen in stably transfected Drosophila
Schneider-2 cells. J Virol Methods 1999, 79: 191–203
12 Roden RB, Hubbert NL, Kirnbauer R, Breitburd
F, Lowy DR, Schiller JT. Papillomavirus L1 capsids agglutinate mouse
erythrocytes through a proteinaceous receptor. J Virol 1995, 69: 5147–5151
13 Rossi JL, Gissmann L, Jansen K, Muller M.
Assembly of human papillomavirus type 16 pseudovirions in Saccharomyces
cerevisiae. Hum Gene Ther 2000, 11: 1165–1176
14 Schiller JT, Lowy DR. Papillomavirus-like
particles and HPV vaccine development. Semin Cancer Biol 1996, 7: 373–382
15 Johanson K, Appelbaum E, Doyle M, Hensley P,
Zhao BG, Abdel-Meguid SS, Young P et al. Binding interactions of human
interleukin 5 with its receptor a subunit. J Biol Chem 1995,
270: 9459–9471
16 Li B, Tsing S, Kosaka AH, Nguyen B, Osen EG,
Bach C, Chan H et al. Expression of human dopamine β-hydroxylase in
Drosophila Schneider 2 cells. Biochem J 1996, 313: 57–64
17 Johansen H, van der Straten A, Sweet R, Otto
E, Maroni G, Rosenberg M. Regulated expression at high copy number allows
production of a growth-inhibitory oncogene product in Drosophila
Schneider cells. Genes Dev 1989, 3: 882–889
18 Aldecoa A, Gujer R, Fischer JA, Born W.
Mammalian calcitonin receptor-like receptor/receptor activity modifying protein
complexes define calcitonin gene-related peptide and adrenomedullin receptors
in Drosophila Schneider 2 cells. FEBS Lett 2000, 471: 156–160
19 Matsumura M, Saito Y, Jackson M R, Song ES,
Peterson PA. In vitro peptide binding to soluble empty class I major
histocompatibility complex molecules isolated from transfected Drosophila
melanogaster cells. J Biol Chem 1992, 267: 23589–23595
20 Zhou J, Doorbar J, Sun XY, Crawford LV, McLean
CS, Frazer IH. Identification of the nuclear localization signal of human
papillomavirus type 16 L1 protein. Virology 1991, 185: 625–632
21 Touzé A, Mahé D, El Mehdaoui S, Dupuy C,
Combita-Rojas AL, Bousarghin L, Sizaret PY et al. The nine C-terminal
amino acids of the major capsid protein of the human papillomavirus type 16 are
essential for DNA binding and gene transfer capacity. FEMS Microbiol Lett 2000,
189: 121–127
22 Li M, Cripe TP, Estes PA, Lyon MK, Rose RC,
Garcea RL. Expression of the human papillomavirus type 11 L1 capsid protein in Escherichia
coli: characterization of protein domains involved in DNA binding and
capsid assembly. J Virol 1997, 71: 2988–2995
23 Chen Y, Ghim SJ, Jenson AB, Schlegel R. Mutant
canine oral papillomavirus L1 capsid proteins which form virus-like particles
but lack native conformational epitopes. J Gen Virol 1998, 79: 2137–2146
