|
|
|
Original Paper
|
|
|||
|
Acta Biochim Biophys
Sin 2008, 40: 497-504 |
||||
|
doi:10.1111/j.1745-7270.2008.00429.x |
Knockdown of insulin-like
growth factor 1 receptor enhances chemosensitivity to cisplatin in human lung
adenocarcinoma A549 cells
Aiqiang Dong1,
Minjian Kong1, Zhiyuan Ma2,
Jianfang Qian1, Haifeng Cheng1,
and Xiaohong Xu3*
1 Department of Cardiothoracic Surgery, Second
Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009,
China
2 Department of Thoracic and Cardiovascular
Surgery, Shanghai Jiao Tong University Affiliated First People's Hospital,
Shanghai 200080, China
3 Department of Endocrinology, Second Affiliated
Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China
Received: March 24,
2008�������
Accepted: May 6,
2008
This work was
supported by a grant from the natural
Science Foundation of Zhejiang Province (Y-204317)
*Corresponding
author: Tel, 86-571-87783516; fax,
86-571-87022660; E-mail, [email protected]
The effects
of RNA interference-mediated insulin-like growth factor 1 receptor (IGF1R) gene
silencing in response to cisplatin (DDP) in the lung cancer cell line A549 in
vivo and in vitro were investigated using two plasmids expressing
short hairpin RNA (shRNA) to IGF1R. A549 cells were transfected with plasmids
expressing each shRNA and then treated with DDP. Semi-quantitative reverse
transcription-PCR and Western blot analysis were used to detect the expression
of IGF1R. MTT assay, flow cytometry and tumor growth assay in athymic nude mice
were used to assess the chemosensitivity to DDP following IGF1R knockdown. Our
data showed that the transfection of A549 cells with shRNA resulted in specific
silencing of IGF1R by 78.9% at the mRNA level and by 89.8% at the protein
level. Down-regulation of IGF1R significantly enhanced cell sensitivity to DDP,
decreased the IC50 of DDP in
A549 cells at 24 h, 48 h and 72 h, and retained 77.5% of A549 cells in the G0/G1 phase.
Furthermore, shRNA-mediated silencing of IGF1R in combination with DDP
treatment enhanced the suppression of tumor growth in both size and weight
by more than 60% and increased apoptosis by more than 75% when compared with
the controls in vivo. Suppression of IGF1R gene expression by shRNA
enhances the chemosensitivity of A549 cells to DDP both in vitro and in
vivo, indicating the therapeutic potential of RNA interference as a method
for gene therapy in treating lung cancer.
Keywords��� lung cancer; insulin-like growth factor 1 receptor; RNA
interference; cisplatin; chemosensitivity
Lung cancer is the leading cause of cancer death worldwide, accounting for 32% of cancer deaths in men and 24% in women. Non-small cell lung cancer (NSCLC) comprises approximately 75%-80% of lung cancers, and the overall 5-year survival rate for NSCLC is only 8%-14% when diagnosed and 40% after complete surgical resection [1,2]. Meta-analysis reveals that combined chemotherapy based on cisplastin (DDP) is the standard therapy for NSCLC; it is recommended by the American Society of Clinical Oncology (ASCO) for patients with advanced stage NSCLC. However, the efficacy of this treatment is limited, and the 5-year survival rate is only 20%-40% [3], which may be due to the multiple drug resistance of NSCLC cells to chemical agents. The development of novel strategies for enhancing chemosensitivity is the focus of much medical research.
Insulin-like growth factor 1 receptor (IGF1R; GenBank accession No. NM_000875) is a receptor protein tyrosine kinase, which is a transmembrane heterotetramer consisting of two a-subunits and two b-subunits linked by disulfide bonds. Binding of ligands to the receptor leads to receptor oligomerization, activation of protein tyrosine kinase, intermolecular receptor autophosphorylation and phosphorylation of cellular substrates that consequently cause gene activation, DNA synthesis and cell proliferation [4-8]. Recent studies have shown that IGF1R is overexpressed in various human cancers, including lung cancer [9], and that overexpression or constitutive activation of IGF1R results in ligand-dependent transformation of fibroblasts [10]. IGF1R also plays a key role in the survival of transformed colonocytes and leads to the development of tumors in nude mice [11,12]. Besides its role in tumorigenesis, IGF1R protects tumor cells from apoptosis induced by chemotherapy, radiotherapy or cytokine [13-15].
In our previous studies [16-18], we constructed IGF1R-specific short hairpin RNA (shRNA)-expressing plasmids and transfected A549 cells. It was found that the proliferation, adhesion and invasion of A549 cells were inhibited. In this study, we further detect the combined effect of IGF1R-specific shRNA with DDP in A549 cells.
Material and Methods
Materials
Anti-IGF1R monoclonal antibody (MS-645-P0) was purchased from Lab Vision (New York, USA). Anti-human actin polyclonal antibody (sc-1616), horseradish peroxidase (HRP)-conjugated goat anti-mouse (sc-2060) and goat anti-rabbit IgG-HRP IgG (sc-2004) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, USA). BLOCK-iTTM U6 RNA interference (RNAi) entry vector kit was purchased from Invitrogen (Carlsbad, USA). AxyPrep Multisource Genomic DNA Miniprep kit was purchased from Axygen Biosciences (Union City, USA). Specific pathogen-free male BALB/cAnNCrj-nu mice (six weeks old) were purchased from the Shanghai Cancer Institute (Shanghai, China). The mice were cared for and used according to Zhejiang University's guidelines.
Construction of plasmids
expressing shRNA targeting IGF1R
Plasmids expressing two shRNAs targeting IGF1R were constructed and designated IGF1R-shRNA1 and IGF1R-shRNA2, respectively [16]. A plasmid expressing shRNA targeting the Photinus pyralis luciferase gene (X65324) was used as a control (control shRNA). The shRNA sequences contained in the IGF1R-shRNA1, IGF1R-shRNA2 and control shRNA were as follows: 5-CAC�C�G�CACA�ATTAC�TGCTCCAAAGACG�AATCTTTG�GAGCAGTAA�TTG�TGC-3, 5-CACCGCCGA�TGTGTGAGAAG�ACCT�T�C����A��A�GAGAGGTCTTCTCACACATCGGC-3 and 5-CA�C�CGCTCACCGGCTCCAGATTTATCGAAA�TAAAT�CT�G�G��AGCCGGTGAGC-3.
Cell culture and transfection
Human lung adenocarcinoma A549 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) at 37 �C with 5% CO2. For transfection, 2 ml of A549 cells was seeded in a 6-well plate at the concentration of 3�105 cells/ml for 16 h. Cells were then transfected with a mixture of 4 mg of each plasmids and 10 ml of Lipofectamine 2000 (Invitrogen) in 2 ml serum-free medium. Six hours after transfection, the medium was replaced with fresh RPMI 1640 medium supplemented with 10% FBS and cultured for 48 h.
Reverse
transcription-polymerase chain reaction (RT-PCR) and Western blot analysis
Total cellular RNA and proteins were prepared as described previously [16]. PCR primer sequences for IGF1R were forward 5-AAATGTGCCCGAGCGTGTG-3 and reverse 5-TGCCCTTGAAGATGGTGCATC-3, and for human b-actin, the internal control, they were forward 5-TTCCA�GCCTTCCTTCCTGGG-3 and reverse 5-TTGCGC�TC�A�G�GAGGAGCATT-3. The thermal cycle conditions were: 94 �C for 3 min followed by 35 cycles for IGF1R (25 cycles for b-actin) at 94 �C for 30 s, 53.5 �C for 30 s, 72 �C for 60 s, and a final extension at 72 �C for 10 min. The PCR product (10 ml) was electrophoresed on 2% agarose, stained with ethidium bromide and visualized by UV absorption.
For Western
blot analysis, 100 mg of total cellular proteins (30 mg for b-actin)
were separated on 10% SDS-polyacrylamide gels, and then transferred to Hybond-P
polyvinylidene difluoride (PVDF) membranes (Amersham, Piscataway, USA). After
the non-specific binding sites were blocked by incubating the membranes in
phosphate-buffered saline-0.1% Tween-20 (PBS-T) without skimmed milk
(Tris-buffered saline-0.1% Tween-20 (TBS-T) with 5% skimmed milk for b-actin) for
0.5 h at room temperature, the membranes were probed with primary antibodies
(1:200 dilution for IGF1R for 2 h; 1:1000 dilution for b-actin for 3 h) at
room temperature, and then washed three times with PBS-T (TBS-T for b-actin).
The membranes were then incubated with HRP-conjugated goat anti-mouse (or goat
anti-rabbit) IgG (1:2500 dilution) for 1 h at room temperature, and washed
three times with PBS-T (TBS-T for b-actin). The blots were developed by chemiluminescence kit
(Roche, Indianapolis, USA), and analyzed using Scion Image software (Scion
Corporation, Frederick, USA).
Assessment of the effect on
the chemosensitivity to DDP by MTT assay
A549 cells were seeded in a 96-well plate at a concentration of 4�103 cells/well for 16 h and then transfected with IGF1R-shRNA1, control shRNA or PBS as the negative control. The medium was changed with RPMI 1640 medium 6 h later. Then, DDP was added to every 4 wells at the concentration of 0.1, 0.5, 1, 2, 4 and 8 mg/L. Cell viability was measured at 24 h, 48 h and 72 h by MTT assay at 570 nm (OD readings) after DDP or PBS treatment. The suppression rate was calculated using the formula:
Eq.
The suppression rate curve at different DDP concentrations was made to calculate the IC50 using curve regression. All the experiments were performed in triplicate.
Evaluation of the effect of
DDP treatment on cell cycle by flow cytometry
A549 cells were seeded into 6-well plates for 16 h and then transfected with IGF1R-shRNA1 or control shRNA. The medium was replaced with RPMI 1640 medium 6 h later. Then, 0.5 mg/L DDP was added into each group. PBS was used as the negative control. Cells were removed by trypsinization 48 h after the addition of DDP, washed in PBS and fixed in 70% ice-cold ethanol for 2 h. The fixed samples were centrifuged, treated with 1 mg/ml RNase solution (Sigma, St. Louis, USA) for 30 min at 37 �C, and resuspended in 0.1 mg/ml propidium iodide (PI) solution (Sigma) at 4 �C for 1 h. PI-stained cells were analyzed with a flow cytometer (BD Biosciences, San Jose, USA). Cell cycle and apoptotic rate were analyzed by CellQuest 3.1f and ModFit 3.0 DNA software (BD Biosciences).
Measurement of the effect on tumorigenicity
in vivo
To assess the effect of IGF1R-shRNA1 on chemotherapy in tumorigenicity, 12 six-week-old, male nude mice were randomly divided into three groups. A549 cells transfected with IGF1R-shRNA1 or control shRNA or treated with PBS were subcutaneously inoculated into murine back region at a concentration of 5�107 cells/mouse. On day 2, mice in the IGF1R-shRNA1 and control shRNA groups were administrated i.p. with 100 ml of 1 mg/L DDP twice a day for 10 d while the mice in the PBS-treated group were administrated i.p. with 100 ml PBS twice a day. Tumor size was measured every 5 d and calculated by the formula:
Eq.
After 30 d, the mice were euthanized. The tumors were removed, fixed by 4% polyformaldehyde, paraffin embedded and sectioned. Formalin-fixed paraffin sections were used for terminal deoxynucleotidyl transferase-mediated digoxigenin-dUTP nick-end labeling (TUNEL) assay. The numbers of apoptotic cells in tumor tissue on each section were counted in 10 different microscopic fields. Proteins were extracted from 50 mg tumor tissue, and Western blotting was used to analyze the expression of IGF1R.
Statistical analysis
All the quantitative data were
presented as mean�SD. The statistical significance of the differences was
determined using Student's two-tailed t-test for two groups and one-way
ANOVA for multiple groups. A P-value less than 0.05 was considered
statistically significant. All the data were analyzed with the SPSS 13.0
software (SPSS, Chicago, USA).
Results
Transfection of shRNA
suppresses IGF1R expression in A549 cells
To inhibit IGF1R gene expression with shRNA, we constructed two plasmids expressing shRNA to IGF1R. RT-PCR and Western blot analysis were performed. The results showed that IGF1R mRNA expression in cells transfected with IGF1R-shRNA1 was 21.1%3.5% of that for those transfected with control shRNA [P<0.05; Fig. 1(A)]. Similarly, immunoblot analysis revealed that the expression of IGF1R protein in A549 cells transfected with IGF1R-shRNA1 was strongly inhibited. Densitometric analysis showed that the amounts of IGF1R protein remaining in cells transfected with IGF1R-shRNA1 and IGF1R-shRNA2 was 10.2%2.8% and 47.9%15.8%, respectively, of that found in cells transfected with the plasmid control shRNA [P<0.05; Fig. 1(B)]. These results indicated that the transfection of shRNA can effectively suppress IGF1R expression. IGF1R-shRNA1 proved to be more potent than IGF1R-shRNA2, so we used IGF1R-shRNA1 in the subsequent experiments.
IGF1R gene silencing sensitizes
A549 cells to chemotherapy
To investigate whether IGF1R down-regulation alters chemosensitivity in A549 cells, we tested DDP in cells transfected with shRNA against IGF1R. The cell growth suppression was measured at 24 h, 48 h, and 72 h by MTT assay, as shown in Fig. 2. The suppression rate in cells transfected with IGF1R-shRNA1, particularly in those treated with 0.5 to 4 mg/L DDP, was significantly higher than those transfected with control shRNA. IC50 at different time points was also markedly decreased (Table 1).
Suppression of IGF1R
expression blocks A549 cells at G0/G1 and increases apoptosis when
combined with DDP
To determine the apoptosis-inducing potential of IGF1R-shRNA1 in A549 cells, flow cytometric analysis of PI-stained cells was performed. As indicated in the previous study [16], the percentage of cells at the G0/G1 population after transfection with IGF1R-shRNA1 (77.5%) was much higher than that observed after transfection with control shRNA (47.2%), and those at S phase and G2/M phase were 15.7% and 7.3% in IGF1R-shRNA1 group, lower than the 23.0% and 29.9% in the control, respectively. The apoptotic rate in cells transfected with IGF1R-shRNA1 combined with DDP (0.5 mg/L) was 44.2%, much higher than that (27.8%) in the control (Fig. 3).
Combination of IGF1R
gene silencing and chemotherapy inhibits in vivo tumorigenicity
We evaluated the effects of receptor blockade on chemotherapy in vivo. The incidence of subcutaneous tumors derived from A549 cells were 100%. The time for tumorigenicity was 20 d for the group treated with IGF1R-shRNA1 and DDP, 20 d for the group treated with control shRNA and DDP, and 15 d for the PBS group. All mice survived for 30 d after inoculation, and the tumor growth rate in the IGF1R-shRNA1 group was much lower than that in the other two groups (P<0.05). The tumor size and weight in the group treated with IGF1R-shRNA1 and DDP were 20.74.2 mm3 and 70.012.0 mg, which was markedly lower than the tumor size (50.315.2 mm3) and weight (180.020.0 mg) in the group treated with control shRNA and DDP (P<0.05; Table 2). The tumors in the group treated with IGF1R-shRNA1 and DDP were oval and had a smooth surface while the tumors in the other two groups were irregular, nodular and rich in vessels (Fig. 4). There was no invasion in any of the groups. These results suggested that the combination of IGF1R gene silencing and chemotherapy could significantly inhibit the tumor growth of A549 cells in nude mice.
Suppression of IGF1R combined
with DDP treatment increases cell apoptosis and decreases IGF1R expression in
established tumors
TUNEL assay was further performed to evaluate apoptosis of tumor tissues in vivo. The number of apoptotic cells was significantly increased in the group treated with IGF1R-shRNA1 and DDP (141.39.1) when compared with the group treated with control shRNA and DDP (34.57.6) (P<0.05; Fig. 5). Western blot analysis showed significantly decreased amounts of IGF1R protein in the group treated with IGF1R-shRNA1 and DDP when compared with the group treated control shRNA and DDP and the PBS group (Fig. 6). These data indicated that shRNA-mediated IGF1R gene silence combined with chemotherapy may also induce apoptosis of A549 cells in vivo.
Discussion
It has been reported that IGF1R mediates tumor growth and protects cancer cells from apoptosis [19-21]. In order to blunt IGF1R function or expression, a number of experimental strategies have been employed. For instance, a-IR3, a monoclonal antibody to IGF1R which blocks IGF1R signaling, significantly inhibits Ewing's sarcoma cells in vitro and induces the regression of established tumors [22]. Genetic blockage can be accomplished using an antisense oligonucleotide [23], and vectors [24] expressing antisense IGF1R mRNA have been shown to inhibit cell growth, suppress tumorigenesis, alter the metastatic potential and prolong survival in vivo. Another approach is to utilize dominant-negative mutants to inhibit the function of the naturally expressed receptor rather than its expression. Using mutant receptors for IGF1R that contain a portion of the molecule including only the extracellular domain or the extracellular domain with a mutant or deleted intracellular tyrosine kinase domain induces differentiation and inhibits adhesion, invasion and metastasis [25-26]. In this study, we constructed two plasmids expressing shRNA to IGF1R under the control of the human U6 promoter, IGF1R-shRNA1 and 2, and then evaluated the effects of shRNA on IGF1R expression in A549 cells. Our results show that IGF1R expression significantly inhibited in A549 cells at both mRNA and protein levels by shRNA to IGF1R [27], suggesting that vector-based RNAi may be a potential approach to cancer gene therapy.
It has also been reported that IGF1R signaling results in
chemotherapy resistance in a wide variety of tumors. For example, blockage of
IGF1R signaling using a monoclonal antibody or RNAi enhances sensitivity to
chemotherapy in breast and liver cancer cell lines [28,29]. An anti-IGF1R
antibody enhances the chemosensitivity to gemcitabine in the pancreatic cancer
xenografts [30], and an antisense inhibition of IGF1R increases sensitivity of
prostate cancer cells to cisplatin, mitoxantrone and paclitaxel [31].
In agreement with these results, our study shows that knockdown of IGF1R by shRNA alters chemosensitivity and results in a significant increase in sensitivity to DDP. Specifically, IGF1R-shRNA1 combined with DDP treatment in A549 cells significantly decreases IC50, arrests A549 cells at G0/G1 and increases apoptosis in vitro. Similarly, suppression of IGF1R combined with DDP treatment inhibits in vivo tumorigenicity, increases cell apoptosis and decreases IGF1R expression in established tumors.
Taken together, our findings indicate that IGF1R expression can be inhibited by shRNA to IGF1R, and shRNA-mediated silencing of IGF1R results in sensitization to DDP in lung cancer A549 cells both in vitro and in vivo. Our results provide further evidence that IGF1R targeting is a potential therapy for human lung cancer.
References
1�� Mezzetti M, Panigalli T, Giuliani L, Raveglia
F, Giudice FL, Meda S. Personal experience in lung cancer sleeve lobectomy and
sleeve pneumonectomy. Ann Thorac Surg 2002, 73: 1736-1739
2�� Greenlee RT, Murray T, Bolden S, Wingo PA.
Cancer statistics. CA Cancer J Clin 2000, 50: 7-33
3�� Bunn PA Jr, Kelly K. New combinations in the
treatment of lung cancer: a time for optimism. Chest 2000, 117: 138-143
4�� Yarden Y, Ullrich A. Growth factor receptor
tyrosine kinases. Annu Rev Biochem 1988, 57: 443-478
5�� Williams LT. Signal transduction by the
platelet-derived growth factor receptor. Science 1989, 243: 1564-1570
6�� Cantley LC, Auger KR, Carpenter C, Duckworth
B, Graziani A, Kapeller R. Oncogenes and signal transduction. Cell 1991, 64:
281-302
7�� Schlessinger J. Signal transduction by
allosteric receptor oligomerization. Trends Biochem Sci 1988, 13: 443-447
8�� Yarden Y, Schlessinger J. Epidermal growth
factor induces rapid, reversible aggregation of the purified epidermal growth
factor receptor. Biochemistry 1987, 26: 1443-1451
9�� LeRoith D, Werner H, Beitner-Johnson D,
Roberts CT Jr. Molecular and cellular aspects of the insulin-like growth factor
I receptor. Endocr Rev 1995, 16: 143-163
10� Kaleko M, Rutter WJ, Miller AD. Overexpression
of the human insulinlike growth factor I receptor promotes ligand-dependent
neoplastic transformation. Mol Cell Biol 1990, 10: 464-473
11� Remacle-Bonnet MM, Garrouste FL, Heller S,
Andre F, Marvaldi JL, Pommier GJ. Insulin-like growth factor-I protects colon
cancer cells from death factor-induced apoptosis by potentiating tumor necrosis
factor alpha-induced mitogen-activated protein kinase and nuclear factor kappaB
signaling pathways. Cancer Res 2000, 60: 2007-2017
12� Singh P. Insulin-like growth factor system in
growth, development and carcinogenesis. J Clin Lig Assay 2000, 23: 214-232
13� Scotlandi K, Maini C, Manara MC, Benini S,
Serra M, Cerisano V, Strammiello R et al. Effectiveness of insulin-like
growth factor I receptor antisense strategy against Ewing�s sarcoma cells.
Cancer Gene Ther 2002, 9: 296-307
14� Turner BC, Haffty BG, Narayanan L, Yuan J,
Havre PA, Gumbs AA, Kaplan L et al. Insulin-like growth factor-I
receptor overexpression mediates cellular radioresistance and local breast
cancer recurrence after lumpectomy and radiation. Cancer Res 1997, 57: 3079-3083
15� Wu Y, Tewari M, Cui S, Rubin R. Activation of
the insulin-like growth factor-I receptor inhibits tumor necrosis
factor-induced cell death. J Cell Physiol 1996, 168: 499-509
16� Dong AQ, Kong MJ, Ma ZY, Qian JF, Xu XH.
Down-regulation of IGF-IR using small, interfering, hairpin RNA (siRNA)
inhibits growth of human lung cancer cell line A549 in vitro and in nude
mice. Cell Biol Int 2007, 31: 500-507
17� Qian J, Dong A, Kong M, Ma Z, Fan J, Jiang G.
Suppression of type 1 Insulin-like growth factor receptor expression by small
interfering RNA inhibits A549 human lung cancer cell invasion in vitro
and metastasis in xenograft nude mice. Acta Biochim Biophys Sin 2007, 39: 137-147
18� Dong AQ, Kong MJ, Ma ZY, Qian JF, Fan JQ, Xu
XH. shRNA-mediated insulin-like growth factor I receptor gene silencing
inhibits cell proliferation, induces cell apoptosis, and suppresses tumor
growth in non-small cell lung cancer: in vitro and in vivo experiments.
Zhonghua Yi Xue Za Zhi 2007, 87: 1506-1509
19� Kulik G, Klippel A, Weber MJ. Antiapoptotic
signaling by the insulin-like growth factor I receptor, phosphatidylinositol
3-kinase, and Akt. Mol Cell Biol 1997, 17: 1595-1606
20� Rochester MA, Riedemann J, Hellawell GO, Brewster
SF, Macaulay VM. Silencing of the IGF1R gene enhances sensitivity to
DNA-damaging agents in both PTEN wild-type and mutant human prostate cancer.
Cancer Gene Ther 2005, 12: 90-100
21� Ma J, Pollak MN, Giovannucci E, Chan JM, Tao
Y, Hennekens CH. Prospective study of colorectal cancer risk in men and plasma
levels of insulin-like growth factor (IGF)-I and IGF-binding protein-3. J Natl
Cancer Inst 1999, 91: 620-625
22� Scotlandi K, Benini S, Nanni P, Lollini PL,
Nicoletti G, Landuzzi L, Serra M et al. Blockage of insulin-like growth
factor-I receptor inhibits the growth of Ewing�s sarcoma in athymic mice.
Cancer Res 1998, 58: 4127-4131
23� Chernicky CL, Yi L, Tan H, Gan SU, Ilan J.
Treatment of human breast cancer cells with antisense RNA to the type I insulin-like
growth factor receptor inhibits cell growth, suppresses tumorigenesis, alters
the metastatic potential, and prolongs survival in vivo. Cancer Gene
Ther 2000, 7: 384-395
24� Lee CT, Wu S, Gabrilovich D, Chen H,
Nadaf-Rahrov S, Ciernik IF, Carbone DP. Antitumor effects of an adenovirus
expressing antisense insulin-like growth factor I receptor on human lung cancer
cell lines. Cancer Res 1996, 56: 3038-3041
25� Yuen JS, Macaulay VM. Targeting the type 1
insulin-like growth factor receptor as a treatment for cancer. Expert Opin Ther
Targets 2008, 12: 589-603
26� Lee CT, Park KH, Adachi Y, Seol JY, Yoo CG,
Kim YW, Han SK et al. Recombinant adenoviruses expressing dominant
negative insulin-like growth factor-I receptor demonstrate anti-tumor effects
on lung cancer. Cancer Gene Ther 2003, 10: 57-63
27� Zhang H, Pelzer AM, Kiang DT, Yee D.
Down-regulation of type I insulin-like growth factor receptor increases
sensitivity of breast cancer cells to insulin. Cancer Res 2007, 67: 391-397
28� Beech DJ, Parekh N, Pang Y. Insulin-like
growth factor-I receptor antagonism results in increased cytotoxicity of breast
cancer cells to doxorubicin and taxol. Oncol Rep 2001, 8: 325-329
29� Niu J, Xu Z, Li XN, Han Z. siRNA-mediated type
1 insulin-like growth factor receptor silencing induces chemosensitization of a
human liver cancer cell line with mutant P53. Cell Biol Int 2007, 31: 156-164
30� Maloney EK, McLaughlin JL, Dagdigian NE
Garrett LM, Connors KM, Zhou XM, Blattler WA et al. An anti-insulin-like
growth factor I receptor antibody that is a potent inhibitor of cancer cell
proliferation. Cancer Res 2003, 63: 5073-5083
31���� Hellawell GO, Ferguson DJ, Brewster SF,
Macaulay VM. Chemosensitization of human prostate cancer using antisense agents
targeting the type 1 insulin-like growth factor receptor. Br J Urol 2003, 91:
271-277