|
|
|
Original Paper
|
|
|||
|
Acta Biochim Biophys
Sin 2008, 40: 729-739 |
||||
|
doi:10.1111/j.1745-7270.2008.00452.x |
Proteome identification of binding-partners interacting with cell polarity protein Par3 in Jurkat cells
Ying Zhou1,2#, Longhou Fang2#�, Dan Du2,3, Wenchao Zhou2,3, Xiujing Feng2,3, Jiwu Chen1, Zhe Zhang2, and Zhengjun Chen2*
1
School of Life Science,
East China Normal University, Shanghai 200062, China
2
State Key Laboratory of
Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai
Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai
200031, China
3
Graduate School of the
Chinese Academy of Sciences, Shanghai 200031, China
Received: April 3, 2008�������
Accepted: May 11,
2008
This work was
supported by grants from the National Natural Science Foundation of China (Nos.
30730055, 30700129 and 30623002) and the National Basic Research Program of
China (No. 2007CB914504)
#These authors
contributed equally to this work
�Current address:
Department of Medicine, University of California, San Diego, CA 92093, USA
*Corresponding
author: Tel, 86-21-54921081; Fax, 86-21-54921081; E-mail, [email protected]
The evolutionarily conserved cell polarity
protein Par3, a scaffold-like PDZ-containing protein, plays a critical role in
the establishment and maintenance of epithelial cell polarity. Although the
role of Par3 in establishing cell polarity in epithelial cells has been
intensively explored, the function of Par3 in hematopoietic cells remains
elusive. To address this issue, we generated GST-fusion proteins of Par3 PDZ
domains. By combining the GST-pull-down approach with liquid
chromatography-tandem mass spectrometry, we identified 10 potential novel
binding proteins of PDZ domains of Par3 in Jurkat cells (a T-cell line). The
interaction of Par3 with three proteins��nuclear transport protein importin-a4 and proteasome activators PA28b and PA28g��was confirmed using in vitro binding assay,
co-immunoprecipitation assay and immunofluorescence microscopy. Our results have
the potential to uncover novel functions of the cell polarity protein Par3 in
blood cells.
Keywords��� cell polarity; Par3; proteomics; importin-a4; PA28b; PA28g
Cell polarity is of crucial importance to the differentiation and functions of most metazoan cells [1,2]. In the early embryogenesis of Caenorhabditis elegans, Par3 localizes asymmetrically at the periphery of the one-cell embryo and is essential for embryonic polarity. Loss-of-function mutation in Par3 gene results in mislocalizing cell fate determinants, incorrectly orientating mitotic spindles and early embryonic lethality [3,4]. Bazooka, the Drosophila orthologues of Par3, is also required for the generation of asymmetric division of neuroblasts and oocyte differentiation [5,6]. In Xenopus, the Par3 forms a complex with Par6/aPKC, which is asymmetrically localized to the animal pole of oocytes [7]. In epithelial cells, Par3 interacts with transmembrane JAM and/or nectin via its PDZ1 domain to facilitate membrane localization [8,9]. As a scaffold protein, Par3 can also interact with Par6/aPKC through its PDZ1 domain to establish tight junctions [10,11], while its C-terminus interacts either with Tiam-1 to regulate the activity of Rac or with LIM kinase 2 to regulate the phosphorylation of coffilin and, hence, the organization of actin filament to promote the establishment of tight junctions [12,13]. The Par3/Par6/aPKC complex also specifies the neuronal axons [14]. Although the function of Par3 has been extensively investigated in epithelial cells and neuron cells, its role in other tissues, such as hematopoietic cells, has barely been explored. While Par3 180K is believed to be involved in the formation of tight junctions, Par3 150K is the major form detected in Jurkat cells [15], strongly indicating that Par3 has different function in the hematopoietic cells.
Par3 protein contains three different PDZ domains. Hitherto, protein partners for the PDZ domains of Par3 have been poorly understood, although some interacting proteins have been revealed [8,10,16]. PDZ domains were originally identified in the postsynaptic density protein PSD95, Drosophila septate junction protein Dlg, and the epithelial tight junction protein ZO-1, hence acronym PDZ. It is one of the well-known domains that mediates protein-protein interactions with a variety of functions, including cell polarization, migration, tumorigenesis, and metastasis. PDZ-containing polarity proteins, include Par3, are differentially localized throughout polarized T cells and regulate T-cell polarity and functions [17]. However, the molecular mechanism by which Par3 participates in T-cell functions is not understood. To find novel Par3- interacting proteins, we carried out GST-fusion protein pull-down assays in Jurkat cells (a T-cell line) by using its PDZ domains as bait. In combination with liquid chromatography-tandem mass spectrometry (LC-MS/MS), 10 potential binding proteins of Par3 were identified. Three of them were further confirmed to be associated with Par3. Our results should help to uncover novel functions of Par3 in blood cells.
Materials and methods
Antibodies and plasmids
Monoclonal antibody against hemagglutinin A (HA) and proteinase inhibitor cocktail tablets (for a broad spectrum of serine and cysteine proteases) were purchased from Roche (Basel, Switzerland). Monoclonal antibody against green fluorescent protein (GFP) was purchased from Santa Cruz Biotechnology (Santa Cruz, USA). Monoclonal antibody against a-tubulin was from Sigma-Aldrich (St. Louis, USA). Polyclonal antibody against Par3 was purchased from Upstate (New York, USA). Antibody against GST was prepared by our own laboratory.
Par3 plasmid was a kind gift from Dr. Ian Macara (University of Virginia, Charlattesville, USA). Par3 PDZ1 domain (251-385 aa) and Par3 PDZ2-3 (425-695 aa) domain were amplified and inserted in-frame into pGEX2T (Amersham Pharmacia Biotech, Forster, USA) or pET-3E-His (kindly provided by Dr. J. Ding of Institute of Biochemistry and Cell Biology, Shanghai, China). To be expressed in mammalian cells, the Par3 PDZ1 cDNA was cloned in-frame into pEGFPC1 by the forward primer 5'-GGAATTCAGAACCTGTTGGACATGCTG-3' and the reverse primer 5'-CGGGATCCGTCAGGG�CTAAA�AC�G�G�CTT-3'.
Par6A cDNA was cloned from normal human liver tissue by the forward primer 5'-CGGGATCCATGAAC�CG�A�AGTTTTCACAAG-3' and the reverse primer 5'-GCT�C�T�AGAGAGCGTGACCGCGGGC-3'. Par6C cDNA was cloned from normal human liver tissue by the forward primer 5'-CGGAATTCCACGAGGCACCTGCGCCTCG-3' and the reverse primer 5'-GCTCTAGAGAG�GCTGAA�G�C�CACTACCATCTC-3' and then cloned into pEGFPC1 or pcDNA3VSV. PA28b and PA28g (kindly provided by Dr. Sherwin Wilk of the Mount Sinai School of Medicine, New York City, USA) were recloned into a mammalian expression vector, pEGFPC1, by the PA28b forward primer 5'-CCGCTCGAGCTATGGCCAAGCCGTGTGG-3' and the PA28b reverse primer 5'-AAAACTGCAGTCAGTA�C�ATAGATGGCTTTTC-3' ; and by the PA28g forward 5'-CC�CAAGCTTCGATGGCCTCGTTGCTGAAG-3' and the PA28g reverse primer 5'-CCGGAATTC�TCA�GTAC�A�G�AGTCTCTGCA-3' respectively.
GST-fusion proteins were produced in Escherichia coli BL21DE and purified on Glutathione Sepharose 4B (Amersham Pharmacia Biotech, Forster City, USA), His-tagged Par3 PDZ2-3 was produced in BL21DE3 and was purified on TALON Metal Affinity Resin (Clontech, USA) according to the standard protocol [18].
Importin-a4 subunit complementary DNA (cDNA) was cloned from human placenta by the forward primer CGGG�A�TCCCGAGCCATGGCGGACAAC and the reverse primer CC�GCTCGAGCTAAAACTGGAACCCTTCTG. It was then inserted in-frame into pcDNA3-N-HA (HA tag in the N-terminus, kindly provided by Dr. G. Pei of the Institute of Biochemistry and Cell Biology, Shanghai, China).
Cell culture and transfection
Human embryonic kidney (HEK) 293T, or 293 cells and HeLa cells (ATCC), were maintained in Dulbecco�s modified Eagle�s medium (Gibco, Carlsbad, USA) supplemented with 10% newborn calf serum (Gibco). Jurkat cells were cultured in RPMI 1640 medium (Gibco) supplemented with 10% newborn calf serum. For exogenous expression of proteins in cells, we used calcium-phosphate-mediated transfection method [19].
In vitro binding assay
Ten million cells were lysed with 1 ml
radio immunoprecipitation assay (RIPA) buffer [50 mM Tris-Cl with pH 7.5, 1%
Triton X-100, 0.1% SDS, 150 mM NaCl, 0.5% sodium deoxycholate, 1 mM NaF, 100 mmol phenylmethyl�sulphonyl
fluoride and cocktail (Roche, Basel, Swi��t�zerland)]. Then the lysate was
incubated with purified GST-fusion proteins conjugated to glutathione 4B beads;
for Coomassie Brilliant Blue staining, 3 mg purified proteins were
used, while for Western blotting, 0.3 mg GST-fusion proteins were used. The beads
were washed with HNTG buffer (20 mM HEPES with pH7.5, 150 mM NaCl, 0.1%
Trition-X-100 and 10% glycerol), unless otherwise mentioned, and eluted with
SDS sample buffer. Proteins were separated by Sodium
dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed using
Coomassie Brilliant Blue R250 staining.
Western blot
Cells were lysed with RIPA buffer. Lysates were quantified using the Bradford quantification method [20]. Proteins were fractionated by one-dimensional SDS-PAGE and analyzed by immunoblotting with proper antibodies. Antibodies were detected by enhanced chemiluminescence (Pierce, Rockford, USA).
Immunoprecipitation
HEK293 cells were washed three times with 0.01 M phosphate-buffered saline (pH 7.4) 24 h after transfection. Cells were lysed in RIPA buffer on ice. After 15 min, the lysates were sonicated for 2�2 s at 100 W and centrifuged at 13,000 rpm for 5 min at 4 �C. The pellets were then discarded.
For immunoprecipitation, rabbit anti-PDZ1 polyclonal antibodies were used. Lysates were mixed with primary antibodies and Protein A-Sepharose beads at 4�C overnight on a head-over-tail rotator. The beads were washed three times with HNTG buffer before loading buffer was added. Then the samples were subjected to SDS-PAGE.
Protein identification by one dimensional-LC-MS/MS
All bands were analyzed using a LCQ Deca XP system (Thermo Finnigan, San Jose, USA). Protein identification by one dimensional-LC-MS/MS was performed as described previously [21]. Data from LC-MS were identified by TurboSequest software (Thermo Finnigan), which used mass spectrometry (MS) and MS/MS spectra of peptide ions to search against the Swiss-Prot non-redundant database (species: Homo sapiens). The protein identification criteria that we used were based on Delta Cn (g 0.1) and Xcorr (one charge g 1.9, two charges g 2.2 and three charges g 3.75).
Immunofluorescent microscopy
Cells grown on glass cover slips (Fisher Biotech, Fairlawn, USA) were washed several times with ice-cold phosphate-buffered saline (PBS), fixed with 3.7% formaldehyde for 10 min, and permeabilized with 0.2% Triton X-100 for 3-5 min. The cells were then blocked in Tris-buffered saline solution with Tween (TBST) containing 1% bovine serum albumin for 1 h at room temperature. Primary antibody incubations were performed at 4 �C overnight in TBST containing 1% bovine serum albumin. After being washed three times in TBST, samples were incubated for 1 h with the secondary antibodies, Alexa Fluor 546 goat anti-rabbit or Alexa Fluor 488 goat anti-mouse IgG (Molecular Probes Invitrogen, Carlsbad, USA). Cover slips were mounted using PermaFluor Aqueous Mounting Medium (Immunotech, Marseille Cedex, France). Samples were analyzed with a laser scanning confocal microscope (Leica, Wetzlar, Germany).
Results
Expression of Par3 150K and 100K in Jurkat cells
Most normal tissues, epithelial cells [10], and tumor cells (data not shown) contain primarily Par3 180K, 150K and 100K. The role of Par3 180K is to establish and maintain tight junctions in epithelial cells. However, there are no tight junctions in Jurkat cells as they are hematopoietic cells. Therefore, the expression pattern of Par3 in Jurkat cells has yet to be determined. SDS-PAGE was used to separate 40 �g lysates from Jurkat cells or Madin-Darby canine kidney (MDCK) cells; they were then analyzed using immunoblotting with antibody against Par3. As shown in Fig. 1, unlike MDCK cells, which expressed large amount of all the three isoforms of Par3, Jurkat cells contained mainly Par3 150K, though there were trace amounts of Par3 180K and Par3 100K (Fig. 1). No signal was detected in the IgG control lanes, and the specific signals of Par3 could be blocked using the purified His-PDZ2-3 protein, which covered 82.9% of the Par3 antigen, suggesting the signals of Par3 in the two cell lines are specific. The different expression pattern of Par3 isoforms in Jurkat cells may be indicative of its different role or different interacting partner(s) in the cells.
Identification of proteins from Jurkat cells interacting with Par3 PDZ domains
We next investigated the possible Par3 PDZ domains-interacting proteins from Jurkat cells. Jurkat cell lysates were first pre-cleared by Glutathione Sepharose 4B beads (GST beads) in order to remove non-specific GST beads-binding proteins. Then the pre-cleared cell lysates were incubated with the recombinant GST-PDZ1 or GST-PDZ2-3 domains of Par3 immobilized on GST beads [Fig. 2(A)]. As shown in Fig. 2(B), four bands, respectively sized 86, 60, 30 and 18 kDa, were specifically pulled down by GST-PDZ1 fusion protein of Par3, and an 80 kDa band and a 70 kDa band by Par3 GST-PDZ2-3 fusion protein. Subsequently, all these bands were selected for LC-MS/MS analysis. In total, 10 different proteins were identified, including proteasome activators PA28b and PA28g, nuclear transport protein, importin-a4, ribosomal proteins and heat shock proteins. Using bioinformatics analysis, the identified proteins were implicated in different cellular functions, such as protein metabolism, energy metabolism and protein transportation (Table 1). The peptides identified by the LC-MS/MS were shown in supplementary data.
Confirmation of the interaction between Par3 and importin-a4, PA28b and PA28g by co-overexpression in HEK293 cells
To confirm the interaction between Par3 and the above identified proteins from Jurkat cells, three important functional proteins, importin-a4, PA28b and PA28g, were selected for further study. After molecularly cloning the cDNA of the selected genes, HA-tagged importin-a4, GFP-tagged PA28b and GFP-tagged PA28g were constructed. Again, in vitro protein pull-down assays were performed by incubating GST-fused Par3 PDZ1 or PDZ2-3 domains with different lysates from HEK293 cells transiently expressing the constructed proteins. As expected, overexpressed importin-a4, PA28b and PA28g could specifically bind to Par3 PDZ1 domain, but not to Par3 PDZ2-3 domains or GST alone (Fig. 3). These findings were consistent with the LC-MS/MS findings.
We next tested whether Par3 is associated with the three proteins in vivo. To clarify this issue, full-length Par3 and PDZ1 domain of Par3 tagged by c-myc were co-transfected with HA-importin-a4, GFP-PA28g or GFP-PA28b in HEK293 cells. We found that Par3 PDZ1 was able to co-precipitate with GFP-PA28γ [Fig. 4(A)], but not with HA-importin-a4 and GFP-PA28b (data not shown). Similarly, the full-length Par3 could interact with PA28γ [Fig. 4(B)], but not with importin-a4 and PA28b (data not shown).
Co-localization of Par3 with importin-a4, PA28g or PA28b detected by immunofluorescence
To further study the interaction between Par3 and these candidate proteins, their subcellular distributions were investigated using immunofluorescent microscopy. HA-importin-a4, GFP-PA28g and GFP-PA28b were respectively overexpressed in HeLa cells together with Par3. Overexpressed Par3 was, in most cases, localized in the cytosol and on the membrane, and had relatively strong signals. Nuclear localization of overexpressed Par3 was occasionally observed with weak signals (Fig. 5). Importin-a usually localized at perinuclear regions. Confocal microscopy showed the perinuclear co-localization of HA-importin-a4 and Par3, which suggested that these two proteins could interact in cells. When PA28b, a cytoplasmic protein, co-transfected with Par3, a clear GFP-PA28b signal on the membrane that codistributed with Par3 was detected. PA28g was reported as a nuclear protein, and indeed, GFP-PA28g localized exclusively in the nucleus, while most Par3 appeared in both the cytosol and nucleus. Strikingly, a proportion of the cells exhibited a strong Par3 signal co-localized with PA28g in the nucleus (Fig. 5, bottom row). Collectively, the immunofluorescence data provided additional evidence for possible subcellular co-localizations between Par3 and the three selected proteins.
Discussion
There are many techniques to systematically investigate protein-protein interactions and protein networks. Among these approaches, GST-pull down in combination with MS offers a fast and efficient way of studying potential molecular interactions. Using this combination of techniques, we identified several novel Par3 PDZ domain-interacting proteins in Jurkat cell (a T-cell line), including importin-a4, PA28b and PA28g. The interactions between these candidate proteins with Par3 were further confirmed using several different approaches.
Par3 is known as an essential player in polarity establishment and maintenance. Interestingly, most identified Par3-interacting proteins in the present work are associated with protein metabolism, such as heat shock proteins (HSP) and proteasome activators PA28b and PA28g; the rest are related to transport (e.g. importin-a4) or unknown functions. This may indicate novel functions of Par3 in hematopoietic cells.
Importin-a
Importin-a plays a critical role in nuclear localization signals (NLS) - mediated nuclear importation process of selective protein [22-24]. In eukaryotic cells, the selective transport of karyophilic proteins to the nucleus is mediated by short amino acid sequences, which are commonly referred to as NLS and are characteristically rich in basic amino acids [25-27]. We found that Par3 from different sources (from Caenorhabditis elegans to human) contained canonical NLS predicted by the PSORT program (http://psort.hgc.jp/) (Table 2). Par3, although localized mainly in the tight junction of Caco-2 or MDCK cells, also showed a clear nuclear signal before cells became polarized [15]. It is not yet understood how Par3 translocates to the nucleus. Our data showed that importin-a co-localized with Par3 in perinuclear structures, indicating that Par3 might directly bind to importin-a to be transported to the nucleus. The predicted NLS localizes in the C-terminus of human Par3 (Table 2), and overexpressed Par3 C-terminus containing the predicted NLS localizes in the nuclei of HeLa/MDCK cells (data not shown). It is possible that Par3 translocates to the nucleus by one or several NLS. However, Par3 does not necessarily need to have a NLS of its own, as Par3 PDZ1 domain might interact with nuclear proteins associated with importin-a; in this way,� it can be translocated to the nucleus through a �piggyback� mechanism [28,29]. Whether Par3 can govern its own nuclear entry or requires an associated partner remains to be determined.
PA28
Our results suggested that Par3 PDZ1 domain interacted with proteasome activators PA28b and PA28g. In cells, proteasome 26S consists of a 20S central component and a 19S regulatory subunit [30,31]. There are two proteasome activators in higher eukaryotes, called PA28 and PA200 [32�34]. Both promote the degradation of peptides and some poorly folded small proteins. PA28 heptamers form donut-shaped rings that bind to the ends of the 20S proteasome and activate peptide hydrolysis by opening the sealed α subunit gate [35].
The PA28 family consists of a, b and g. PA28a and PA28b form 3a/4b-heteroheptamers that are found mostly in the cytoplasm [36,37]. In addition to the cytoplasmic signal, our data revealed that PA28b co-localized with Par3 on the membrane (Fig. 5). The significance of this translocation of PA28b is not clear. It has been reported that cell polarity or tight junction protein stability is regulated by proteasome degradation. During development, tissue repair and tumor metastasis, both cell-cell dissociation and cell migration occur and appear to be intimately linked, and what happened during epithelial �scattering� is a good example for that. Interestingly, proteasome inhibitors prevented the redistribution of proteins of the tight junction and the adherens junction during cell scattering. Moreover, proteasome inhibition partly preserved cell polarity during scattering. Thus, a proteasome-dependent step during scattering appears to be involved in the loss of polarity protein [38]. The Par3-PA28b interaction may be involved in proteasome-dependent degradation of tight junction components during cell scattering. Yet, as a tight junction protein itself, Par3 can be a substrate of PA28b as well.
PA28g (originally named Ki antigen) forms homoheptamers that localize in the nucleus. Consistent with this, overexpressed Par3 and PA28g co-localized in the nuclei of HeLa cells in our study. Our previous results showed that Par3 may play a role in DNA repair via binding to Ku70/Ku80 [39]. Whether nuclear co-localized PA28 is involved in Par3-Ku70/Ku80-regulated DNA repair is an interesting question. One relevant observation was that a certain proportion of cells exhibited strong nuclear signal of Par3 co-localized with PA28g when both were overexpressed (Fig. 5, bottom row). This phenomenon did not appear when Par3 was co-transfected with importin-a4 or PA28b. It is accepted that Par3, as a tight junction protein, plays different roles by forming different complexes in its variant subcellular locations. For example, Par3 was reported to localize in centrosome during cell mitosis, indicating the involvement of Par3 in cell proliferation [40]. Par3 was also shown to localize at the leading edge of lamellipodia in migration cells [41]. All these data indicate that to function properly, Par3 may localize differently in cells at different stages and/or under distinct stimuli to interact with the applicable local binding partners.
Other candidate proteins
Several HSPs were pulled down by Par3 PDZ domains. HSP 70 from E. coli can bind to ribosome-bound nascent polypeptides [42]. Here, both HSP and ribosome were found to associate with Par3, and the interaction might be involved in the protection of tight junctions in epithelial cells during heat stress.
It should be noted that we unequivocally detected peptides corresponding to the P isoform of phosphofructokinase (PFK), which likely constitute the intense band observed in around 80 kDa [Fig. 2(B)] (Table 1). This probably reflects this enzyme�s great abundance within the pool of proteins that associate with Par3 PDZ1. In fact, enzymes, such as GADPH, aldolase, pyruvate kinase, PFK and lactate dehydrogenase, have been observed to assemble at microtubules. Their interactions are advantageous for glycolysis [43,44]. Interestingly, Par3 associates with microtubule-based molecular motors dynein LC8 [45]. Par3 might form a complex with PFK-dynein so that they function together.
It has been reported that T lymphocytes expressed mainly Par6C and a low level of Par6B [46]. However, we failed to identify Par6 in the present analysis, though the GST-Par3 PDZ1 fusion protein was proved to bind Par6 in other cell lines, such as HEK293 (data not shown). In our assay, the 45 kDa band of Par6C may be too close to the GST-PDZ1 band, and thus be masked [Fig. 2(B)]; the amount of the proteins around 55-60 kDa (the size of Par6B) pulled down by GST-PDZ1 was too low for MS analysis. Though people often refer to a Par3/Par6/aPKC complex with the implication that these three proteins are constitutively linked to one another, this complex can in fact be both functionally and spatially separate [47,48]. We previously identified Ku70/Ku80 as Par3-interacting factors in HeLa and A431 cells[39]. In Jurkat cells, using GST-Pars PDZ2-3, we pulled down protein bands approximately the size of Ku70/Ku80. However, the 80 kDa band was insufficient in amount for MS analysis, while the large amount of HSP 70 could cover the weaker signal of Ku70. This might be due to the distinct expression levels of Ku70/Ku80 in different cell lines.
Although the interaction between Par3 and importin-a4, PA28b or PA28g was confirmed by several methods, we were unable to co-precipitate importin-a4 or PA28b with Par3. This may be due to several reasons. First, the interaction between importin-a4 or PA28b and Par3 in cells could be transient and/or stimulation dependant. Second, the conformation of Par3 in cells might be different from that of the recombinant GST-Par3. Therefore, the association between importin-a4 or PA28b and Par3 in cells might be rare or transient. This could suggest certain functions of Pars are stimulation dependant. Consistent with this, Par3 was recently identified as a novel component of the DNA-dependent protein kinase complex, and its nuclear signal could be clearly enhanced by certain stimuli [39]. In a constitutive situation, the Par3-importin-a4 association might be very loose. Upon certain stimulation, their interaction would be greatly enhanced, and Par3 could go into the nucleus to enhance DNA-dependent protein kinase complex activity for efficient DNA repair. Comparably, Par3 may only interact with PA28b during cell scattering to help in proteasome-dependent degradation of tight junction proteins or to be degraded itself. Yet, most likely, this is because importin-a4/Par3 and PA28b/Par3 complexes were not stable under the conditions that we used for immunoprecipitation. This assumption is supported by the co-localization of these proteins detected by immunofluorescence in cells (Fig. 5).
We attempted to elucidate protein functions by unraveling interactions that occur in cells. In this paper, we identified three novel Par3-interacting partners, importin-a4, PA28b and PA28. Our findings may shed light on the novel functions of Par3 in blood cells.
References
1�� Drubin DG, Nelson WJ.
Origins of cell polarity. Cell 1996, 84: 335-344
2�� Knoblich JA. Mechanisms
of asymmetric cell division during animal development. Curr Opin Cell Biol
1997, 9: 833-841
3�� Etemad-Moghadam B, Guo S,
Kemphues KJ. Asymmetrically distributed Par3 protein contributes to cell
polarity and spindle alignment in early C. elegans embryos. Cell 1995,
83: 743-752
4�� Bowerman B, Ingram MK,
Hunter CP. The maternal Par genes and the segregation of cell fate
specification activities in early Caenorhabditis elegans embryos.
Development 1997, 124: 3815-3826
5�� Schober M, Schaefer M,
Knoblich JA. Bazooka recruits inscuteable to orient asymmetric cell divisions
in Drosophila neuroblasts. Nature 1999, 402: 548-551
6�� Wodarz A, Ramrath A,
Kuchinke U, Knust E. Bazooka provides an apical cue for inscuteable
localization in Drosophila neuroblasts. Nature 1999, 402: 544-547
7�� Nakaya M, Fukui A, Izumi
Y, Akimoto K, Asashima M, Ohno S. Meiotic maturation induces animal-vegetal
asymmetric distribution of aPKC and ASIP/PAR-3 in Xenopus oocytes.
Development 2000, 127: 5021-5031
8�� Ebnet K, Suzuki A,
Horikoshi Y, Hirose T, Meyer Zu Brickwedde MK, Ohno S, Vestweber D. The cell
polarity protein ASIP/PAR-3 directly associates with junctional adhesion
molecule (JAM). EMBO J 2001, 20: 3738-3748
9�� Takekuni K, Ikeda W,
Fujito T, Morimoto K, Takeuchi M, Monden M, Takai Y. Direct binding of cell
polarity protein Par3 to cell-cell adhesion molecule nectin at neuroepithelial
cells of developing mouse. J Biol Chem 2003, 278: 5497-5500
10� Lin D, Edwards AS, Fawcett JP,
Mbamalu G, Scott JD, Pawson T. A mammalian Par3-Par6 complex implicated in
Cdc42/Rac1 and aPKC signalling and cell polarity. Nat Cell Biol 2000, 2: 540-547
11� Izumi Y, Hirose T, Tamai Y,
Hirai S, Nagashima Y, Fujimoto T, Tabuse Y et al. An atypical PKC
directly associates and colocalizes at the epithelial tight junction with ASIP,
a mammalian homologue of Caenorhabditis elegans polarity protein Par3. J
Cell Biol 1998, 143: 95-106
12� Chen X, Macara IG. Par3
controls tight junction assembly through the Rac exchange factor Tiam1. Nat
Cell Biol 2005, 7: 262-269
13� Chen X, Macara IG. Par3
mediates the inhibition of LIM kinase 2 to regulate cofilin phosphorylation and
tight junction assembly. J Cell Biol 2006, 172: 671-678
14� Shi SH, Jan LY, Jan YN.
Hippocampal neuronal polarity specified by spatially localized Mpar3/Mpar6 and
Pi 3-kinase activity. Cell 2003, 112: 63-75
15� Yoshii T, Mizuno K, Hirose T,
Nakajima A, Sekihara H, Ohno S. sPar3, a splicing variant of Par3, shows
cellular localization and an expression pattern different from that of Par3
during enterocyte polarization. Am J Physiol Gastrointest Liver Physiol 2005,
288: G564-G570
16� Joberty G, Petersen C, Gao L,
Macara IG. The cell-polarity protein Par6 links Par3 and atypical protein
kinase C to Cdc42. Nat Cell Biol 2000, 2: 531-539
17� Ludford-Menting MJ, Oliaro J,
Sacirbegovic F, Cheah ET, Pedersen N, Thomas SJ, Pasam A et al. A
network of PDZ-containing proteins regulates T-cell polarity and morphology
during migration and immunological synapse formation. Immunity 2005, 22: 737-748
18� Sambrook J, Irwin N, Janssen
KA. Expression of cloned genes in Escherichia Coli. New York: Cold
Spring Harbor Laboratory, 2001
19� Graham FL, van der Eb AJ. A new
technique for the assay of infectivity of human adenovirus 5 DNA. Virology
1973, 52: 456-467
20� Bradford MM. A rapid and
sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Anal Biochem 1976, 72: 248-5421
21� Li C, Tan YX, Zhou H, Ding SJ,
Li SJ, Ma DJ, Man XB et al. Proteomic analysis of hepatitis B
virus-associated hepatocellular carcinoma: Identification of potential tumor
markers. Proteomics 2005, 5: 1125-1139
22� G�rlich D, Prehn S, Laskey RA,
Hartmann E. Isolation of a protein that is essential for the first step of
nuclear protein import. Cell 1994, 79: 767-778
23� Imamoto N, Shimamoto T, Takao
T, Tachibana T, Kose S, Matsubae M, Sekimoto T et al. In vivo
evidence for involvement of a 58 kDa component of nuclear pore-targeting
complex in nuclear protein import. EMBO J 1995, 14: 3617-3626
24� Moroianu J, Hijikata M, Blobel
G, Radu A. Mammalian karyopherin alpha 1 beta and alpha 2 beta heterodimers:
alpha 1 or alpha 2 subunit binds nuclear localization signal and beta subunit
interacts with peptide repeat-containing nucleoporins. Proc Natl Acad Sci USA
1995, 92: 6532-6625
25� Dingwall C, Laskey RA. Nuclear
targeting sequences�a consensus? Trends Biochem Sci 1991, 16: 478-481
26� Makkerh JP, Dingwall C, Laskey
RA. Comparative mutagenesis of nuclear localization signals reveals the
importance of neutral and acidic amino acids. Curr Biol 1996, 6: 1025-1027
27� Garcia-Bustos J, Heitman J,
Hall MN. Nuclear protein localization. Biochim Biophys Acta 1991, 1071: 83-101
28� Zhao LJ, Padmanabhan R. Nuclear
transport of adenovirus DNA polymerase is facilitated by interaction with
preterminal protein. Cell 1988, 55: 1005-1015
29� Dingwall C, Sharnick SV, Laskey
RA. A polypeptide domain that specifies migration of nucleoplasmin into the
nucleus. Cell 1982, 30: 449-458
30� Yang Y, Fr�h K, Ahn K, Peterson
PA. In vivo assembly of the proteasomal complexes, implications for
antigen processing. J Biol Chem 1995, 270: 27687-27694
31� Orlowski M, Wilk S.
Ubiquitin-independent proteolytic functions of the proteasome. Arch Biochem
Biophys 2003, 415: 1-5
32� Ma CP, Slaughter CA, DeMartino
GN. Identification, purification, and characterization of a protein activator
(PA28) of the 20 S proteasome (macropain). J Biol Chem 1992, 267: 10515-10523
33� Dubiel W, Pratt G, Ferrell K,
Rechsteiner M. Purification of an 11 S regulator of the multicatalytic
protease. J Biol Chem 1992, 267: 22369-22377
34� Ustrell V, Hoffman L, Pratt G,
Rechsteiner M. PA200, a nuclear proteasome activator involved in DNA repair.
EMBO J 2002, 21: 3516-3525
35� Whitby FG, Masters EI, Kramer
L, Knowlton JR, Yao Y, Wang CC, Hill CP. Structural basis for the activation of
20s proteasomes by 11s regulators. Nature 2000, 408: 115-120
36� Realini C, Jensen CC, Zhang Z,
Johnston SC, Knowlton JR, Hill CP, Rechsteiner M. Characterization of
recombinant REGalpha, REGbeta, and REGgamma proteasome activators. J Biol Chem
1997, 272: 25483-25492
37� Rechsteiner M, Hill CP.
Mobilizing the proteolytic machine: cell biological roles of proteasome
activators and inhibitors. Trends Cell Biol 2005, 15: 27-33
38� Tsukamoto T, Nigam SK.
Cell-cell dissociation upon epithelial cell scattering requires a step mediated
by the proteasome. J Biol Chem 1999, 274: 24579-24584
39� Fang L, Wang Y, Du D, Yang G,
Kwok TT, Kong SK, Chen B et al. Cell polarity protein Par3 complexes
with DNA-PK via Ku70 and regulates DNA double-strand break repair. Cell Res
2007, 17: 572-574
40� Davis GE, Koh W, Stratman AN.
Mechanisms controlling human endothelial lumen formation and tube assembly in
three-dimensional extracellular matrices. Birth Defects Res C Embryo Today
2007, 81: 270-285
41� Shin K, Wang Q, Margolis B.
PATJ regulates directional migration of mammalian epithelial cells. EMBO Rep
2007, 8: 158-164
42� Young JC, Agashe VR, Siegers K,
Hartl FU. Pathways of chaperone-mediated protein folding in the cytosol. Nat
Rev Mol Cell Biol 2004, 5: 781-791
43� Volker KW, Reinitz CA, Knull
HR. Glycolytic enzymes and assembly of microtubule networks. Comp Biochem
Physiol B Biochem Mol Biol 1995, 112: 503-514
44� V�rtessy BG, Orosz F, Kov�cs J,
Ov�di J. Alternative binding of two sequential glycolytic enzymes to
microtubules. Molecular studies in the phosphofructokinase/aldolase/microtubule
system. J Biol Chem 1997, 272: 25542-25546
45� Navarro-L�rida I, Mart�nez
Moreno M, Roncal F, Gavilanes F, Albar JP, Rodr�guez-Crespo I. Proteomic
identification of brain proteins that interact with dynein light chain LC8.
Proteomics 2004, 4: 339-346
46� Real E, Faure S, Donnadieu E,
Delon J. Cutting edge: atypical PKCs regulate T lymphocyte polarity and
scanning behavior. J Immunol 2007, 179: 5649-5652
47� Martin-Belmonte F, Mostov K.
Phosphoinositides control epithelial development. Cell Cycle 2007, 6: 1957-1961
48� Harris TJ, Peifer M. The positioning and segregation of apical cues during epithelial polarity establishment in Drosophila. J Cell Biol 2005, 170: 813-823