Categories
Articles

ACTA BIOCHIMICA et BIOPHYSICA SINICA

Hammerhead
Ribozymes Suppress HBV(adr) in HepG2 Cells

ZHENG
Wen-Chao*, LU Chang-De, KONG Yu-Ying, WANG Yuan, QI Guo-Rong**

( Shanghai Institute of Biochemistry,
the Chinese Academy of Sciences, Shanghai,
200031 )

Abstract        Three hammerhead ribozymes (RS3, RC2 and
RC1) targeting to the HBV genome have been designed. Plasmids were constructed
by inserting the genes of naked and tRNA-embedded ribozymes into RNA trimming vector
pRG523 and then were transferred to eukaryotic expression vector. By the
similar cloning method the shotgun-type plasmids carrying homogeneous RS3 or
RtS3 unit-connected in tandem were obtained. After co-transfecting the above
plasmids and HBV genome-containing plasmid into human hepatoma cell line HepG2
respectively and selection by G418, the HBV-inhibiting activity of different
kinds of ribozyme in G418-resistant cells was achieved by measuring the
decrease of HBV-RNA, progeny DNA and the antigens expressed. The results showed
that all the ribozymes were active with more than 70% inhibition activity
against the HBV and that tRNA-embedded ribozymes had higher activity than naked
ribozymes. It is worth particular interest that shotgun-type ribozymes with the
connected unit in tandem with 8 and 12 units constructed in the plasmid
revealed the highest activity, reaching >90% inhibition.

Key
words
    hammerhead ribozyme; HBV;
HepG2 cells

HBV
is a small spherical hepatotropic DNA virus, causing not only acute and chronic
B-type hepatitis but also hepatocellular carcinoma. It is widely distributed
throughout the world. There are at least four proteins encoded by the HBV
genome: protein S, C, X and a specific DNA polymerase (pol) as shown in Fig.1.
HBV replicates asymmetrically through reverse transcription of an intermediate
called pre-genome RNA, pgRNA. For targeting the HBV mRNA and pgRNA, a series of
nucleic acid agents such as antisense oligonucleotides[13]
and ribozymes, including both hammerhead[4
7]
and hairpin[8] structure, have been designed and used in vitro
and/or in vivo, with the attempt to block the expression and replication
of HBV, thereby to inhibit and prevent the HBV infection.

In
order to compare the anti-HBV activity of different kinds of hammerhead
ribozymes(Rz), plasmids, including naked, tRNA-embedded[6,7] or
shotgun type ribozymes against HBV DNA (adr) at 3 sites(see Fig.1), were
constructed from the trimming plasmid pRG523[10] and co-transfected
into HepG2 cells with HBV genome-containing plasmid p1.2 II respectively. The
results indicated that the relative amounts of HBV RNA, progeny DNA and antigen
proteins to the control were remarkably decreased, among which the activity of
tRNA-embedded ribozymes was higher than that of naked ribozymes (see also
ref.7) and particularly the shotgun-type ribozymes with unit number connected
up to 8 or 12 had the highest activity (>90% inhibition).

Fig.1       HBV(adr)
genome-containing p1.2 II plasmid and the cut sites of designed ribozymes

(A) the structure of plasmid p1.2 II, the
HBV(adr)[9] genome is in the box, the arrows show the
position of the sites as in the mRNAs or pgRNA cut by designed ribozymes (RS3,
RC2, RC1 and RtS3, RtC2, RtC1). (B) HBV genes: Gene C expresses both antigen C
(HBcAg) and antigen e (HBeAg); Gene S, Gene X and Gene P express HBsAg, protein
X and a specific polymerase respectively.

1    Materials and Methods

Three
ribozymes RS3, RC2 and RC1 against HBV(adr) shown in Fig.1 were designed
with the computer analysis[11]. The tRNA-embedded ribo-zymes, RtS3,
RtC2 and RtC1, were obtained by inserting the above ribozymes into the anticodon
of a modified human tRNAMet (see ref.6) respectively. All the
synthetic ribozyme fragments were cloned into pRG523[10] by means of
appropriate restriction enzymes. The resulting plasmids were denoted as pTRS3,
pTRC2 and pTRC1 as well as pTRtS3, pTRtC2 and pTRtC1[6]. With the
similar cloning method, the plasmids carrying homogeneous unit-connected
ribozymes pT2RS3(n=2), pT4RS3(n=4), pT8RS3(n=8), pT12RS3(n=12)
and pT12RtS3(n=12) were also obtained(Fig.2). These plasmids were
linearized and transcribed by T7 RNA polymerase, and the active trans-ribozymes
can be produced in vitro(data not shown). All the above plasmids were
transferred into a plasmid which possesses human cytomegalovirus (hCMV)
promoter and neomycin resistance gene (Neo) driven by thymidine kinase (TK)
promoter and a set of ribozyme genes-containing eukaryotic expression plasmids
was obtained (Fig.2). The prefix in the name of those produced plasmids is
changed to pC from pT counterpart, e.g. pTRS3 to pCRS3, pTRtS3 to pCRtS3 and so
on. Control plasmids are named as pCR53 and pCRt, in which the whole ribozyme
sequences are deleted.

Fig.2       Part of organization of ribozyme
expression plasmids

*,
active center sequence: CUGAUGAGUCCGUGAGGACGAA[12]; **, embedded
tRNA: modified human tRNAMet(see ref.6).

HepG2
cells were propagated in DMEM (Gibco-BRL) containing 10% fetal bovine serum,
100 units/ml penicillin, 100 mg/L streptomycin and 2 mmol/L l-glutamine
at 37
and 5% CO2. The cells were plates in a 6-well plated (3.5
×106
cell per well) 18
24
h prior to transfection. Transfection was achieved with 7.5
ml
Lipofectin reagent (1 g/L), 1
mg
of p1.2 II and 0.05
mg
ribozyme expression plasmid according to the protocol of supplier(Gibco-BRL).
Selection for neomycin resistance was done with G418(geneticin, Sigma) at
concentration of 400 mg/L DMEM. Two weeks after transfection, colonies from
each transfection were harvested with trypsin, mixed and then expanded up to
>107 cells for analysis.

Dot
blotting, Southern blotting and RNase protection assay were done according to
the standard procedures[13]. Labeled antisense probes of HBV and
b-actin
RNAs were transcribed from corresponding plasmids after linearlization in
vitro
[7]. 3.8 kb HBV DNA probe was prepared from p1.2 II by a
random primed method. 200
mg
total RNA prepared from transfected cells was used for dot blotting while
progeny DNA prepared from 1
×106
transfected cells was used for Southern blotting. 2
×106
cells were seeded in 23 cm2-tissue culture plate in 5 ml of DMEM
supplemented with 10% FBS for enzyme-linked immunosorbent assay (ELISA) of
HBsAg, HBeAg and HBeAg/HBcAg was carried out by using the protocol of commercial
kits (KeHua Co, China).

2    Results and Discussion

Human
hepatoma cell line HepG2, shown to be competent for HBV replication after
transfection with cloned HBV DNA, can maintain high levels of expression of HBV
genes and produce infectious HBV after transfection with closed circular HBV
DNA[14], which implicates that HepG2 cells are suitable to be used
in studying the anti-HBV effect of ribozymes in human cells. Ribozyme genes
under the control of hCMV promoter were linked with TK-Neo gene in the plasmid,
so almost every G418 resistant cell contained ribozyme gene after selection
once or more times if necessary. Most resistant cells also contain HBV(3.8 kb)
sequence after co-transfection. Southern blotting demonstrated that average
copies of 3.8 kb per cell ranged 0.78
0.88
or 0.81
0.91
among G418 resistant cells (data not shown). The difference is quite slight and
it reveals that the results shown in Fig.3 are mainly caused by
ribozyme-mediated cleavage, not from transfection discrepancies. Similar evidence
came from the small RNAs of total RNAs extracted from G418 resistant cells: the
small RNA contained in vitro ribozyme cleavage activity targeting the
corresponding substrates (unpublished data, see also references 16 and 18).

Fig.3       Decrease of HBV-RNA (A) and
progeny DNA (B) in the G418-resistant HepG2 cells after treatment with
shotgun-type hammerhead ribozymes

(A)
HBV-RNA detected by RNase-protection method using
b-actin mRNA as control (nt, nucleotide
residue). (B) Progeny DNA identified by Southern blotting method.

The
HBV-inhibiting activity of different kinds of ribozymes in HepG2 cells with three
aspects: decrease of HBV RNA, inhibition of progeny DNA synthesis and reduction
of HBV antigens is shown in Fig.3 and Fig.4. The results of the HBV RNA
decrease and inhibition of progeny DNA synthesis in the G418-resistant HepG2
cell line after treatment with the shotgun-type hammerhead ribozymes are shown
in Fig.3. The relative amounts of HBV-RNA, progeny DNA (data from Fig.3 of this
paper and Ref.7) and antigens detected by ELISA method are shown in Fig.4. The
combined results indicated: (1) all the ribozymes designed and expressed are
active in transfected cells with >70% inhibition activity in comparison with
none ribozyme sequence control, (2) the HBV-inhibiting activity of
tRNA-embedded ribozymes is higher than that of naked ribozymes by about 10%30%,
and (3) the shotgun-type expression system is obviously effective to inhibit
the HBV in HepG2 cells. The extent of the effectiveness depends on the linked
number connected in tandem of the plasmids: the larger the number, the higher
the activity. When the number is linked up to 8 or 12, the HBV-inhibiting
activity reach >90% inhibition (see 8RS3 or 12RS3 in Fig.3).

Fig.4       The relative amounts of HBV-RNA,
progeny DNA and antigens in the G418-resistant HepG2 cells

The amount of HBsAg in supernatant
detected only when ribozymes RS3 and RtS3 cut in the surface antigen region
were used (see Fig.1) and the amount of HBeAg in supernatant or HBeAg/HBcAg in
cell lysate detected when ribozymes. RC1, RtC1 and RC2 cut in the core antigens
region were used (see Fig.1).

In
conclusion, our results indicated that the shotgun-type ribozymes with more
than 8 connected units (Fig.2, n=8 or 12) were the best for inhibiting
expression and replication of HBV genes in stable, long-term system in
comparison with other type of ribozymes. It must be mentioned that in this
study non-toxicity for the HepG2 cells lasted for several months (data not
shown).

For
eliminating the effect of non-pairing extra flanking sequences on the ribozyme
and target RNA, the RNA trimming vector[10,15] has been used to
construct trans ribozyme-containing plasmids. All the plasmids
constructed here were cloned into the trimming vector pRG523[10].
This effective maternal plasmid prepared in our lab has high self-cleavage
activity, thus trans ribozyme can be released easily. By means of the
pRG523, a series of studies of hammerhead ribozymes against viruses, including
HPV (human papilloma virus)[16], HAV (hepatitis A virus)[17],
NPV (nuclear polyhedrosis virus)[18], and also mRNAs, including ADA
(adenosine dea-minase)[19], PCNA(proliferating cell nuclear antigen,
cyclin)[20], MDR (multidrug resistance)[21] mRNA, in
vitro
and in vivo has been performed in our lab.

In
the published works the mutantly disabled or crippled ribozyme were generally
used as control for measuring the anti-virus activity of active ribo-zyme[4,5,8].
According to the mode of action[11,22] ribozymes appear to act as
both antisense and cleavage function. In general, under the given conditions
ribozyme activity for blocking the gene expression should be higher than that
of the antisense oligonucleotide alone. This conclusion proved to be true after
we compared the inhibition activity of active and inactive ribozymes in the
same system for targeting the PCNA[20] and HPV-16[16] as
well as HBV genes in our lab (unpublished data). From a practical point of
view, one of the overall strategies is how to combine the advantages of
antisense and cleavage function and thus to design and select new ribozyme
molecules.


Acknowledgments  We thank Mr.CHEN Nong-An for assistance
with the designing of the the ribozymes and Ms.ZUANG Ming for oligonucleotides
synthesis.

 

References

1     Offensperger WB, Offensperger
S, Walter E, Teubner K, Igloi G, Blum HE, Gerok W. In vivo inhibition of
duck hepatitis B virus replication and gene expression by phosphorothioate
modified antisense oligodeoxynucleotides. EMBO J, 1993, 12(3):
1257
1262

2    Korba BE, Gerin J L. Antisense oligonucleotides
are effective inhibitors of hepatitis B virus replication in vitro. Antiviral
Res
, 1995, 28(3): 225
242

3     Nakazono K, Ito Y, Wu CH, Wu
GY. Inhibition of hepatitis B virus replication by targeted pretreatment of
complexed antisense DNA in vitro. Hepatology, 1996, 23(6):
1297
1303

4     Fritz von Weizsacker F, Blum
H E, Wands J R. Cleavage of hepatitis B virus RNA by three ribozymes
transcribed from a single DNA template. Biochem Biophys Res Commun,
1992, 189(2): 743
748

5     Beck J, Nassal M. Efficient
hammerhead ribozyme-mediated cleavage of the structured hepatitis B virus
encapsidation signal in vitro and in cell extract, but not in intact
cells. Nucleic Acids Res, 1995, 23(24): 4954
4962

6     Zheng W, Qi GR. tRNA-embedded
hammerhead ribozymes mediate destruction of HBV(subtype adr) in vitro.
Acta Biochimica et Biophysica Sinica, 1998, 30(5): 432
438

7     Zheng W, Qi GR. Anti-HBV
activity of tRNA-embedded ribozymes in HepG2 cells. Chinese Journal of
Biochemistry and Molecular Biology
, 1999, 15(4): 563
567

8     Welch P J, Tritz R, Yei S,
Barber J, Yu M. Intracellular application of hairpin ribozyme genes against
hepatitis B virus. Gene Therapy, 1997, 4(7): 736
743

9
Wang Y, Li Z P. Hepatitis B virus genome: Structure and function. In: Wen Y M, Xu
Z Y, Melnick J L eds. Viral Hepatitis in China: Probloms and
Control Strategies. Monographs Virology
, Basel: Karger Press, 1992, 19:
1
19

10
   He YK, Lu CD, Qi GR. In
vitro
cleavage of HPV 16 E6 and E7 fragments by synthetic ribozymes and
transcribed ribozymes from RNA-trimming plasmid. FEBS Lett, 1993,
322(1): 21
24

11
   Lu CD, Chen NA, Qi GR.
Computer analysis of the cleavage reaction of hammerhead ribozyme. Acta
Biochimica Biophysica Sinica
, 1996, 28(3): 279
285

12
   Hertel KJ et al. Numbering
system for the hammerhead. Nucleic Acids Res, 1992, 20(12):
3252

13
   Shambrook J, Fritsch EF,
Mannitis T. Molecular Cloning: A Laboratory Manual, 2nd ed, New York:
Cold Spring Harbor Lab Press, 1989

14
   Chang C et al.
Production of hepatitis B virus in vitro by transient expression of
cloned HBV DNA in a hepatoma cell line. EMBO J, 1987, 6(3): 675
680

15
   Taira K, Nakagawa K,
Nishikawa S, Furukawa K. Construction of a novel RNA-transcript-trimming
plasmid which can be used both in vitro in place of run-off and (G)-free
transcriptions and in vivo as multi-sequences transcription vectors. Nucleic
Acids Res, 1991, 19(19): 5125
5130

16
   Huang YZ, Kong YY, Wang Y, Qi
GR, Lu CD. Stable expression of anti-HPV 16 E7 ribozyme in CV-1 cell line. Chinese
Journal of Biotechnology
, 1996, 12(4): 385
389

17
   Jin ZY, Lu CD, Li GD, Qi GR.
Design and properties of ribozyme for site-specific cleavage of RNA fragment
derived from hepatitis A virus. Chinese Journal of Virology, 1993, 9(1):
1
6

18
   Zhang XL, Zhang F, Qi GR, Lu
CD. The protection of B. mori cells by ribozyme upon NPV-infection. High
Technology letters
, 1997, 7(4): 23
27

19
   Chen H, Lu C D, Qi G R.
Co-cleavage of the murine adenosine deaminase mRNA with mixed ribozymes. Acta
Biochimica Biophysica Sinica
, 1994, 26(6): 603
606

20
   Jin Z Y, Qi G R, Lu C D.
Effect of inhibition of expression PCNA with ribozyme on the proliferation of
cells. Acta Biologiae experimentalis Sinica, 1996, 29(4): 351
356

21
   Yuan YW, Zhang JR, Qi GR, Lu
CD. The reversion of multidrug resistance in tumour cell line MCF-7/Adr
by ribozyme. National Medical Journal of China, 1997, 77(7): 494
496

22
   Perreault JP, Labuda D, Usman
N, Yang JH, Cedergren R. Relationship between 2′- hydroxyls and magnesium
binding in the hammerhead RNA domain: A model for ribozyme catalysis. Biochemistry,
1991, 30(16): 4020
4025


Received: July 11, 2000         Accepted:
August 18, 2000

This work was supported by the State 863
High Technology R & D Project of China (863-102-18-47) and the National
Nature Science Foundation of China (No. 29632060)

*Current address: Department of
Pharmacology, Medical School, University of Wisconsin 1300 University Avenue,
Madison, WI 53706, USA

**Corresponding author: Tel,
86-21-64374430; Fax, 86-21-64338357; e-mail, [email protected]