Categories
Articles

ACTA BIOCHIMICA et BIOPHYSICA SINICA

https://www.abbs.info
e-mail:[email protected]

ISSN 0582-9879                        
      
        ACTA BIOCHIMICA et
BIOPHYSICA SINICA 2002, 34(2): 143-148              
                
     CN 31-1300/Q

Cloning,  Expression and Immunization of the New
Antigen Gene Sj-Ts4 of Schistosoma japonicum

ZHOU
Dong-Ming, YI Xin-Yuan*, ZENG Xian-Fang, WANG Min,

CAI
Chun, WANG Qing-Lin, ZHANG Shun-Ke, MCREYNOLDS Larry1

(
Department of Parasitology, 
Xiangya School of Medicine, 
Central South University, 
Changsha
410078, 
China;

1Molecular
Parasitology Group, New England Biolabs, Inc., MA
01915,
USA
)

Abstract    In order to explore the molecular mechanism of
high immune protection against schistosomes infection in animals infected with Trichinella
spiralis
,  and to provide
several cross-protective antigen genes for developing anti-schistosomiasis
vaccine,  a Schistosoma
japonicum
adult worm cDNA library was immunoscreened using sera taken from
mice infected with Trichinella spiralis.  Nine positive clones were obtained after 3 rounds of
immunoscreening.  Among them,  Sj-Ts4 represents a novel gene
of S. japonicum,  which
coding for a novel protein of 210 amino acids.  The protein has a deduced molecular mass of 23 kD and
isoelectric point of 7.72. Sj-Ts4 was expressed as a
glutathione-S-transferase (GST) fusion protein by cloning into the prokaryotic
expression vector pGEX-5X-3.  The
recombinant Sj-Ts4 protein (rSj-Ts4) was purified and could be recognized by
sera of mice infected with S.japonicum.  Vaccination of several groups of mice with rSj-Ts4 or rSj-Ts4
incorporated into Freund’s complete adjuvant induced high titers of specific
IgG antibodies.  Two vaccination
groups all obtained significant reduction in worm burden (31.36%, 36.80%,
P<0.01),  compared with the control groups.

Key
words
    Schistosoma japonicum;
Trichinella spiralis; Sj-Ts4; molecular cloning; immunization

Vaccine development
has been proved to be the most effective strategy for the prevention and the
control of many infectious diseases[1].  Since there are many difficulties in prophylaxis and in treatment
of schistosomiasis,  which remains
one of the major public health issues in many developing countries,  successful control of schistosomiasis
might be also achieved through vaccine. 
Searching for ideal antigen molecules for developing anti-schistosomiasis
vaccine is now a key topic in schistosomiasis research[2, 3]. 

Analysis of
cross-reactivity among antigens from schistosomes and other parasites is of
importance for understanding the evolutionary conservation of antigens and for
the development of sensitive and specific serodiagnostic assays,  and in getting useful antigen for
developing vaccine against parasites. 
It has been found that there are many antigens shared between Trichinella
spiralis
and schistosomes[4
7].  One molecule responsible for the
observed cross-reactivity between S.mansoni and T.spiralis has
been identified by the monoclonal antibodies prepared against S.mansoni
glycoproteins[4],  and
heterologous preparations from T.spiralis can provide up to 80.48%
87.86%
protection in mice against S.mansoni[8].  Previous studies in our laboratory have
shown that the antigens of cercariae, 
schistosomula,  female worms
of S. japonicum,  were
recognized by sera from rabbits immunized with T.spiralis antigens or by
sera from T.spiralis infected rabbits.  The molecular weights of recognized antigen ranges from 15
kD to 100 kD,  especially located
in 35 kD to 38 kD.  Studies of
cross-protection have shown that the preliminary infection of mice with T.spiralis
could induce high immune protection against subsequent challenge with S.japonicum[7].  So it is feasible of finding out
several cross-protective antigen genes through studying on molecular mechanism
of the immunological cross-reactivity between schistosomes and T.spiralis.

Here we report the
molecular cloning and sequencing of the Sj-Ts4  that was obtained from immunoscreening of S.japonicum
adult worm cDNA library using sera of mice infected with Trichinella
spiralis
.  In addition to
sequence analysis,  we have
expressed the Sj-Ts4 in prokaryotic expression vector and demonstrated that a
partial protection against S.japonicum infection was induced by
vaccination with the recombinant protein.

1 
Materials and Methods

1.1 
Preparation of sera

Kunming mice were
infected with T.spiralis larvae. 
Ten days later,  these mice
were repeatedly infected with T. spiralis,  150 larvae for each mouse at each time.  Thirty days after second
infection,  the mice were bled and
sera were separated and stored at -20
.

1.2 
Immunoscreening of Sj adult worm cDNA library

A Philippine strain S.japonicum
adult worm cDNA library constructed in Uni-ZAP XR was a gift from Molecular
Parasitology Unit,  Queensland
Institute of Medical Research, 
Australia.  The pooled sera
from mice infected with T.spiralis used in library screening were
pre-absorbed several times with the E.coli BB4 lysate in order to reduce
the cross-reactivity to E.coli. 
Horseradish peroxidase conjugated goat anti-mouse IgG (H+L) (New England
Biolabs,  Inc.) was employed as
second antibody.  Immunoscreening
of cDNA library was performed according to standard procedure[9].  After 3 rounds of screening and
purification,  nine positive clones
were isolated and their phage DNA were prepared using the methods described by
Sambrook et al[10].

1.3 
DNA sequencing

The cDNA inserts in
Uni-ZAP XR vector were PCR amplified using M13 forward and reverse primers
(forward,  TGACCGGCAGCAAAATG;  reverse,  AACAGCTATGACCATGA
.  After further purifying,  the PCR products were automatically
sequenced on the ABI PRISM 377 sequencer using the methods of dideoxynucleotide
sequencing.  Both strands of these
clones were fully sequenced.  The
sequence data were analyzed using Nucleotide BLAST software of NCBI and Expert
Protein Analysis System (Swiss Institute of Bioinformatics).

1.4 
Subcloning and expression

The isolated S.
japonicum
gene was expressed as a glutathione-S-transferase (GST) fusion
protein by subcloning into the prokaryotic expression vector pGEX-5X-3.  Briefly,  the open reading frame (ORF) starting with the first ATG was
PCR amplified using primers flanked with EcoRI and XhoI sites (Sj-Ts4F,  CTGGAATTCATGGCCTGTCAACATGTA;  Sj-Ts4R,  CGACTCGAGTTACCACCAGAAACTT-G)
respectively.  The PCR condition
used were 32 cycles of 94

for 30  s,  54

for 1 min and 72

for 3 min.  After digestion with EcoRI
and XhoI,  the PCR product
was then subcloned into pGEX-5X-3 vector. 
The expression vector with new S. japonicum gene was used to
transform E.coli DH5
a.
The transformants were grown at 37

in LB medium,  containing 100 mg/L
ampicillin.  When culture reached
an A600=0.5, 
isopropylthio-
b-D-galactoside
(IPTG) was added to a final concentration of 1.0 mmol/L.  Further 4 h for growing,  the cultures were harvested by spinning
at 4 000 r/min for 15 min at 4
.  The pellet was resuspended in PBS
containing 0.05% Tween-20 of 1% of the original volume and lysed by sonication
on ice,  and then centrifuged at 10
000 r/min for 20 min at 4
.  The supernatant was applied to
glutathione-Sepharose 4B beads (Pharmacia) and extensively washed with
PBST.  Factor Xa was injected into
the column and the column was maintained at room temperature overnight.  Therefore the fusion protein was
site-specific cleaved and the recombinant Sj-Ts4 was eluted with 50 mmol/L
Tris/HCl (pH 7.7) containing 100 mmol/L NaCl.

1.5 
Immunization and challenge

Recombinant Sj-Ts4 was
used to immunize female Kunming mice. 
For primiary immunization, 
each mouse in two vaccination groups were subcutaneously injected at
multiple sites with 50
mg
of recombinant protein or same dose of recombinant protein emulsified in 0.1 ml
complete Freund’s complete adjuvant (FCA),  respectively. 
Two control groups were set up at the same time,  and were injected with FCA or with TBS
buffer.  These initial injections
were followed by two sets of boosts at two weeks intervals.  Two weeks after last immunization,  the blood samples were collected by
tail vein puncture and each mouse was percutaneously infected with 40 cercariae
of S. japonicum.  All mice
were sacrificed and perfused 5 weeks later and the worm recovered were
counted.  Protection was assessed
as the percentage reduction in worm burden in the vaccinated animals compared
with controls.  Analysis of
variance was used to analyze the statistical significance of any difference.

1.6 
Enzyme-linked immunosorbent assay (ELISA)

96-well,  flat-bottomed microtiter plates were
coated with 5
mg
rSj-Ts4 per well in 100
ml
coating buffer (0.05 mol/L carbonate buffer,  pH 9.6) over night at 4
.  Blocking was with 3% skim milk and
0.05% Tween-20 in PBS.  One hundred
ml
of appropriately diluted individual sera in PBS were added and the plates
incubated for 2 h at 37
.  After washing,  horseradish peroxidase labelled goat
anti-mouse IgG conjugates were added (100
ml
per well,  1
3
000 dilution) and the plates incubated for 1 h.  Following further washing,  the reaction with 3, 3
,
5, 5
-tetramethyl-benzidine (TMB) was carried
out for 10 min,  the optical
density was measured at 595 nm using microplate model E960(ERMA,  Inc.). 

1.7 
SDS-PAGE and Western blotting

10% SDS polyacrylamide
gels were normally used to analyze the recombinant protein.  After electrophoresis,  one gel was Coomassie blue-stained to
visualize the protein bands and another one was transferred onto nitrocellulose
membrane for further immunological detection using the same HRP-conjugate as
above followed by development with 0.05% diaminobenzonic acid solution.  S.japonicum chronic infection
mouse sera were from Kunming mice infected with 40 cercariae and bled at 45
days post-infection.

2 
Results

2.1 
Isolation and characterization of cDNA encoding Sj-Ts4

Screening 4×105
plaques of an S.japonicum adult worm cDNA library resulted in the
identification of nine positive plaques that remained positive after 3 rounds
of immunoscreening.  Sequence
analyses indicated that the sequence of clone 4 (Sj-Ts4) is 1 016
bp.  It contains 1 ORF beginning
with the initiation codon ATG at position 142 to 144 and ending with a TAA
termination codon at position 774 to 776. 
The ORF is preceded by a 141 bp 5

untranslated region and is followed by a 223 bp 3

untranslated region in addition to the poly A tail.  The nucleotides around this start codon (GATATGG) fulfill
Kozak’s criteria[11] for a strong ribosomal initiation site
(ACCATGG),  and a polyadenylation
signal (AATATAAA) was positioned 14 bp upstream of the poly A tail
(Fig.1).  The nucleotide sequence
data reported here is available in GenBank database under accession number
AF308144.

Fig.1  Nucleotide and deduced amino acid
sequences of Sj-Ts4

The
Kozak sequence and the polyadenylation signal are italic.

2.2 
Deduced amino acid sequence and analytical secondary structure of Sj-Ts4

Sj-Ts4
encodes a protein of 210 amino acids, 
as inferred from its nucleotide sequence.  The translation product of this cDNA has a deduced molecular
mass of 23 kD and an isoelectric point of 7.72.  A sequence similarity search using the deduced amino acid
sequence revealed that there is no significant similarity with other
species.  This peptide lakes a signal
peptide,  instead of containing two
N-glycosylation sites(amino acids 19
22
and 102
105),  one N-myristoylation site(amino
acids 98
103),  three phosphorylation sites for protein
kinase C(amino acids 62
64,  127129
and 194
196)
and six for casein kinase II (amino acids 20
23,  3538,  6063,  8285,  170173
and 186
189).  Besides,  a potential O-glycosylation site was deduced at
residue 194.  SOPMA prediction
indicate that this protein is rich in
α-helix
(55.71%) and random coil (35.71%) secondary structure.  The amino acid sequence was predicted
as a soluble protein,  which
probably located in cytoplasm.

2.3 
Cloning,  expression and
identification of rSj-Ts4

Confirmed by DNA
sequencing,  the Sj-Ts4
expression plasmid pGEX-Sj-Ts4 was successfully constructed
(Fig.2).  E.coli DH5
a  transformed with the pGEX-5X-2/Sj-Ts4
were cultured overnight and then to induce by adding IPTG.  A 49 kD fusion rSj-Ts4/GST protein was
expressed in high quantity and a 23 kD recombinant rSj-Ts4 was obtained after
digestion of the fusion protein with factor Xa,  which was analyzed by 10% SDS-PAGE (Fig.3).  Chronic infection mice sera were used
in Western blotting to probe rSj-Ts4 and fusion protein,  and they could recognize the purified rSj-Ts4,  the fusion protein (rSj-Ts4/GST) and
GST (Fig.4).

Fig.2  Construction of Sj-Ts4
expression plasmid of pGEX-Sj-Ts4

Fig.3  SDS-PAGE analysis of rSj-Ts4
expression product in E.coli

M, protein molecular weight marker; 1,
the supernatant of the lysate of E.coli DH5
a  induced with IPTG; 2, pGEX expression product;
3, the expressed product of pGEX-Sj-Ts4 (upper arrow indicated the
fusion protein); 4, rSj-Ts4 (lower arrow) recovered after factor Xa
cleavage.

Fig.4  Western blot analysis of the rSj-Ts4
expression product probed with mice sera infected with S.japonicum

M, protein molecular weight marker; 1, E.coli
DH5
a  control; 2, pGEX expression product; 3,
the expressed product of pGEX-Sj-Ts4; 4, the purified rSj-Ts4.

2.4 
Vaccination experiments

Compared with control
groups,  vaccination with rSj-Ts4
or rSj-Ts4 plus FCA stimulated high levels of IgG in mice after the third
immunization.  The titers of
specific IgG in sera before challenge reached 1
25
600 in both vaccination groups, 
which were significant higher than those of the control groups
(Fig.5).  Thirty-five days after
challenge,  all mice were perfused
and the worm numbers of four groups were counted.  Significant worm reduction rates were obtained in two
vaccination groups,  a little of
high immune protection could be found in group vaccinated with rSj-Ts4 plus FCA
compared with the group immunized with rSj-Ts4 alone,  but there was no statistical significance between two
vaccination groups (36.80%, 31.36%, P>0.05) (Table 1) .

Fig.5  Titration of IgG antibodies of mice
vaccinated three times with rSj-Ts4

3 
Discussion

It is well known that
concurrent infection with two or more parasite species in mammalian host models
may result in heterologous antagonistic and synergistic interactions, which
were characterized by ranging in magnitude from reduced/enhanced growth and
fecundity to blockage/enhancement of establishment/explusion[12
14].  Heterologous anta-gonism can be
observed in animals infected with T.spiralis and schistosomes.  It has long been believed that some
antigens common to both species might be responsible for the high level of
immune resistance to following schistosome infection in mice infected with T.spiralis[7],  but none of the cross-reactivity
antigenic genes has been cloned. 
We therefore screened a S.japonicum cDNA library using sera of
mice infected with T.spiralis to search for new powerful antigens. 

We described the
cloning,  characterization and
vaccination studies with a novel S.japonicum antigen,  Sj-Ts4 in this study.  Complete sequencing of the insert
showed that the clone contain one open reading frame coding for 210 amino
acids.  The protein was deduced
containing several phosphorylation sites for protein kinase C and for casein
kinase II,  so Sj-Ts4 may be
activated by phosphorylation.  Five
of the near terminal ten residues in Sj-Ts4 are serine and threonine.  These residues,  apart from being potentially
phosphoylated,  commonly have O-linked
addition of the monosaccharide N-acetylglucosamine(O-GlcNAc).  It has been speculated that O-GlcNAc
may have some regulatory function in proteins.  This is due to O-GlcNAc levels can change rapidly in
lymphocytes in response to mitogens[15].  Furthermore, 
the likely attachment sites for O-GlcNAc are almost identical to
those of regulatory protein kinases, 
most of the O-GlcNAc-modified proteins also being
phospho-proteins[16]. 
The protein was also predicated as a soluble protein and located in cytoplasm.  As there was no overall similarity of Sj-Ts4
with any known proteins,  the
structure and function of Sj-Ts4 should be further studied.

Recombinant Sj-TS4
protein could be recognized by chronically infected mice sera.  Immunization experiment showed that rSj-Ts4
was highly immunogenic.  Single or
with FCA preparations,  high
specific antibody levels were induced throughout,  which suggests that this molecule may be of importance in
vaccine immunity.  Partial
protection against S. japonicum infection could be stimulated in
experimental group vaccinated with rSj-Ts4,  and the recombinant protein plus FCA could induce more
significant protection.  FCA as an
effective adjuvant has been widely used in vaccination research,  which can not only enhance the effect
of immune against challenge but also induce immunity of anti-embryonation when
used in vaccination against schistosomes[17].  

    Although comparable level of immune protection
has not been induced in this study as shown in previous reports that the
animals were vaccinated with naive cross-reactivity antigens shared between
schistosome and T.spiralis, 
the results we report here are encourage and hopeful.  Further investigation will be done to
characterize this new antigen immunologically and biochemically,  and particularly to evaluate its
potential as a vaccine candidate in mouse model. 


Acknowledgments    We thank Dr.  ZHOU Jin-Chun (Department  of Parasitology,  Central South University) for her kind
guidance in screening the S.japonicum cDNA library,  Professor McManus DP (Molecular
Parasitology Unit,  Queensland
Institute of Medical Research, 
Australia) for gifting S.japonicum cDNA library,  Dr.WANG Jian-Jun (Department  of Biochemistry,  Central South University) for providing
us E.coli DH5
a.

References

1  Hinman A.  Eradication of vaccine-preventable diseases.  Annu Rev Public Health,  1999,  20:  211229

2  Cai XZ,  Tian E,  Yang
GZ,  Shi FH,  Shen W,  Cai YM,  Wu
XF.  Cloning of Schistosoma
japonicum
Chinese strain fatty acid binding protein (Sj-FABPc) gene and its
overproduction in Escherichia coli.  Acta Biochim 
Biophys Sin
,  1998,  30(2):  203
206

3  Cai XZ,  Lin JJ,  Yang GZ, 
Shi FH,  Shen W,  Cai YM,  Wu XF. 
Cloning of Schistosoma japonicum Chinese strain TPI gene and
characterization of its expression product in Escherichia coli. 
Acta Biochim Biophys Sin, 
1998,  30(5):  454
458

4  Hillyer GV,  Gomez de Rios I.  The
enzyme-linked immunosorbent assay (ELISA) for the immunodiagnosis of schistosomiasis. 
Am J Trop Med Hyg,  1979,  28(2):  237
241

5  Aronstein WS,  Lewis SA, 
Norden AP,  Dalton JP,  Strand M.  Molecular identity of a major antigen of Schistosoma mansoni
which cross-reacts with Trichinella spiralis and Fasciola hepatica.  Parasitology,  1986,  92(1): 
133
151

6  Linder E,  Thors C,  Lundin
L,  Ljungstrom I,  Farah S,  Hagi H,  Dias
F.  Schistosome antigen gp50 is
responsible for serological cross-reactivity with Trichinella spiralis.  J Parasitol,  1992,  78(6): 
999
1005

7  Tian ML,  Yi XY,  Zeng
XF,  Zeng QR.  Identification of antigens shared
between Schistosoma japonicum and Trichinella spiralis.  Bulletin of Hunan Medical University,  1998,  23(3): 
225
228

8  Youssef MM,  Abu Samra LM,  Hegazy
IH.  Immunization against Schistosoma
mansoni by using Trichinella spiralis and Trichinella
pseudospiralis antigens.  J Egypt Soc Parasitol,  1991,  21(2):  309
318

9  Young RA,  Davis RW.  Gene
isolation with lambda gt11 system. 
Methods Enzymol, 
1991,  194:  230
238

10  Sambrook J,  Fritsch EF, 
Maniatis T.  Molecular
Cloning:  A Laboratory
Mannul,  2nd ed,  New York: Cold Spring Harbor Laboratory
Press,   1989, 16
22

11  Kozak M.  Point mutations define a sequence flanking the AUG initiator
codon that modulates translation by eukaryotic ribosomes.  Cell,  1986,  44(2):  283
292

12  Christensen NO,  Furu P,  Kurtzhals J, 
Odaibo A.  Heterologous
synergistic interactions in concurrent experimental infection in the mouse with
Schistosoma mansoni, 
Echinostoma revolutum,  Plasmodium yoelii,  Babesia microti,  and Trypanosoma brucei.  Parasitol Res,  1988,  74(6): 
544
551

13  Christensen NO,  Odaibo AB,  Simonsen PE. Echinostoma population regulation in
experimental rodent definitive hosts. 
Parasitol Res, 
1988,  75(2):  83
87

14  Christensen NO,  Nansen P,  Fagbemi BO, 
Monrad J.  Heterologous
antagonistic and synergistic interactions between helminths and between
helminths and protozoans in concurrent experimental infection of mammalian
hosts.  Parasitol Res,  1987,  73(5): 
387
410

15  Kearse KP,  Hart GW. 
Lymphocyte activation induces rapid changes in nuclear and cytoplasmic
glycoproteins.  Proc Natl Acad
Sci USA
,  1991,  88(5):  1701
1705

16  Haltiwanger RS,  Kelly WG,  Roquemore EP, 
Blomberg MA,  Dong LY,  Kreppel L,  Chou TY  et
al
.  Glycosylation of nuclear
and cytoplasmic proteins is ubiquitous and dynamic.  Biochem Soc Trans,  1992,  20(2):  264
269

17  Boulanger D,  Warter A, 
Sellin B,  Lindner V,  Pierce RJ,  Chippaux JP, 
Capron A.  Vaccine potential
of a recombinant glutathione S-transferase cloned from Schistosoma haematobium
in primates experimentally infected with an homologous challenge.  Vaccine 1999, 17(4):  319
326


Received: August 17, 2001
    Accepted: November 8, 2001

This work was
supported by Funds for Vaccine against Schistosomiasis of WHO/TDR
No.980268

*Corresponding
author: Tel, 86-731-4805405; Fax, 86-731-4498311; e-mail,
[email protected]