Categories
Articles

ACTA BIOCHIMICA et BIOPHYSICA SINICA

https://www.abbs.info e-mail:[email protected]

ISSN 0582-9879                        
      
        ACTA BIOCHIMICA et
BIOPHYSICA SINICA 2002, 34(6): 697-702                               
     CN 31-1300/Q

Increasing
Bioactivity of Flt3 Ligand by Fusing Two Identical Soluble Domains

LU
Chang-Ming, YU Jian-Feng, HUANG Wei-Da1,

ZHOU
Xuan, ZHANG Wei-Yan, XI Hong, ZHANG
Xue-Guang
*

(
Biotechnology Research Institute, Soochow University, Suzhou
215007,
China;

1
Department of Biochemistry, School of
Life Sciences, Fudan University, Shanghai
200433,China
)

Abstract    Flt3 ligand (FL) is a hematopoietic growth factor,
initiating its intracellular signaling cascade by binding to counterpart
receptor and driving receptor dimerization. The native form of soluble FL in
vivo
is mainly monomeric. In this study, we constructed a rFL-FL fusion
protein cDNA by linking two copies of cDNA encoding the soluble domain of FL in
tandem and expressed it in Pichia pastoris. On SDS-polyacrylamide gel
electrophoresis, the rFL-FL fusion protein showed a molecular weight of 43 kD,
agreeing well with the predicted value. The 43 kD protein was further confirmed
by Western blot using polyclonal rabbit anti-human FL antibody. The rFL-FL
fusion protein exhibited about 10-fold increment in its activity on colony
formation of bone marrow progenitor cells. rFL-FL fusion protein also exerted more
potent effect than monomeric FL on extending the survival of starving Raji
cells.

Key
words
   rFL-FL fusion protein;
linker; Pichia pastoris; hematopoietic colony formation

FL,
the ligand for the Flt3 tyrosine kinase receptor, is a hematopoietic growth
factor that plays a key role in the growth and differentiation of
primitive  hematopoietic cells[1],
it is also an important cytokine involved in innate and specific immune
response[2,3]. FL shares many characteristics with macrophage
colony-stimulating factor (M-CSF) and c-kit receptor ligand (KL). Like M-CSF
and KL, there are multiple forms of FL that are generated from alternative
transcripts in vivo. The predominant isoform of FL is a transmembrane
protein that has a proteolytic cleavage site within the extracellular domain at
amino acid 156157
and is readily cleaved to a soluble protein about 17.686 kD[4
6],
which lacks an intermolecular disulfide bond, resulting in dimers associated
through noncovalent interactions[7]. Mechanisms by which FL activates
its cell surface receptor Flt3 are thought to be similar to those involved in
other PDGF receptor family members. It has been proposed that cellular
activation by PDGF receptor family is due to the binding of individual subunits
of the dimeric ligand to separate receptor molecules that leads to the
formation of and/or stabilization of receptor dimers[8]. Mutations
that disrupted the dimerization interface were predicted to shift the
equilibrium from dimeric to monomeric FL and reduce the biological activity of
the mutation protein significantly[9].

The
therapeutic potential of recombinant FL was showed by its efficacy in several
preclinical animal models. Administration of FL to mice at a dose of  500
mg/kg
a day protected mice from a lethal dose of irradiation and lead to a dramatic
increase in the number of circulating progenitor cells[10]. Studies
in both animal and human also demonstrated that recombinant FL could stimulate
the generation in vivo of dentritic cell[11]. It has been
suggested recently that FL, administered either alone or in combination with
other cytokines in murine model, could effectively inhibit the growth and
metastasis of malignancies of liver, lung and breast[3]. However,
like KL, FL had an important dose-dependent response, especially in stem cells
mobilization. Although FL appears to have a good safety profile, potential
toxicity also exists in vivo treatment[12]. Therefore, it is
useful to increase the biological activity so as to reduce the dose of FL by
generating a stable dimeric FL.

We
now report the production of a recombinant fusion protein consisting of two
complete human FL molecules in tandem separated by a 15-amino acid linker. The
FL-FL fusion protein (rFL-FL) displayed an enhanced bioactivity and therefore
would be a more suitable candidate for clinical application.

1  Materials and Methods

1.1 
Materials

1.1.1  Plasmid, E.coli strains and FL cDNA    Cloning vector
pBluescriptIISK(pSK), and the Escherichia coli strains XL1-Blue,
TOP10 were purchased originally from Stratagene(USA), Pharmacia (Sweden) and
Invitrogen (USA). The yeast expression system for Pichia pastoris
EasySelectTM was purchased from Invitrogen. Synthesis of artificial
cDNA encoding human FL was reported previously[13].

1.1.2  Reagents   
All restriction endonucleases and T4 DNA ligase we used were purchased
from Takara Biotech (Dalian, China). Yeast extract and peptone were from Oxford
(USA). Polyclonal rabbit anti-human FL antibody was obtained from Immugenex (USA).
ELISA kit for quantitative analysis of FL was purchased from R&D (UK). BM
chemiluminescence Western blot kit (mouse/rabbit) was gotten from Boehiringer
Mannheim (Germany). Recombinant hFL expressed in E.coli was purchased
from Immunex (USA), and used as standard rhFL for bioassay.

1.2 
Methods

1.2.1  Construction of FL-FL cDNA    FL-FL fusion protein cDNA was constructed by
linking two copies of cDNA corresponding to the soluble domain (1
151
amino acids) of FL ligand through a linker sequence as shown in Fig.1. The
first copy (FL-1) was obtained by PCR amplification of FL cDNA[13]
using primes FL-1-1 (GAGTGCTC-GAGAAGAGAGAGGCTGAA) and FL-1-2
(GAG-AAGCTTCAAGTGGTCTAGGACT), in which the 151st amino acid codon ACA (Thr) was
changed to TCA (Ser) so that a HindIII restriction site was created for
cloning. The second copy FL-2 was generated by PCR amplification with
primers FL-2-1 (GACTAGGATCCACTCAAGACTGTTCTTTCCA) and FL-2-2
(GTCATTCTAGATCATGGAGCT-GTAGGTGCTG). The linker sequence encoded three repeats
of pentapeptide GGGGS, with restriction sites HindIII and BamHI at its 5

and 3
ends. The linker was first cloned into
pSK vector and then FL-1 and FL-2 were cloned into the derived
pSK-Linker plasmid by restriction sites XhoI/HindIII and BamHI/XbaI,
respectively. The derived plasmid was noted as pSK-FLFL, and
confirmed by DNA sequencing on an automatic DNA sequencer.

1.2.2  Expression of FL-FL fusion protein in Pichia
pastoris   
The FL-FL
fusion protein cDNA was subsequently cleaved from pSK-FLFL with XhoI
and XbaI, and introduced into yeast expression vector pPICZ
aA
supplied by Invitrogen, which carries an
α
factor secretion signal sequence and a Zeocin marker gene for antibiotic
selection. The resulted plasmid pPICZ
aA-FLFL
was then linearized with SacI and introduced into Pichia pastoris
by electroporation according to the protocols provided by Invitrogen.
Recombinants were selected by plating cells on YPD/Zeocin plates containing 10
g/L yeast extract, 20 g/L peptone, 20 g/L dextrose and 100 mg/L of Zeocin.
Colonies that grew on the YPD/Zeocin plates were picked up for screening in
BMGY medium[10 g/L yeast extract, 20 g/L peptone, 100 mmol/L potassium
phosphate (pH 6.0), 1.34% yeast nitrogen base with ammonium sulfate, 0.4 mg/L
of biotin and 1% glycerol], followed by BMMY medium containing the same
components as BMGY except for the replacement of 1% glycerol with 0.5%
methanol.

Large-scale
production of rFL-FL was carried out in 2-L baffled shaker flasks. The
transformants were cultured in 250 ml phosphate-buffered BMGY medium shaking at
250 r/min at 30

until A600 reached 2
6.
Cells were then harvested by centrifuging at 3 000 g for 5 min, and
resuspended in 1 L BMMY medium. Methanol was supplemented every 24 h to a final
concentration of 0.5%. For quantitative analysis, aliquots of 1 ml of
supernatant were taken at 24, 48, and 72 h and the recombinant protein was
quantified by ELISA either immediately or after storage at -20
.

1.2.3  Identification of the recombinant protein    Recombinant protein secreted
in the culture media of transformants was analyzed by immunoblotting. Protein
samples were separated on SDS-PAGE (12% acrylamide), then transferred onto
ployvinylidene difluoride membranes on a semi-dry transfer (Bio-Rad). The
membranes were subjected to Western blot analysis with rabbit polyclonal
antibody against human FL (Immugenex) as the primary antibody, and horse-redish
peroxidase-labelled goat-anti-rabbit IgG as secondary antibody.

1.2.4  Purification of rFL-FL    The supernatants of centrifuged culture media
were concentrated by ultrafiltration using 10 kD-molecular cut-off membranes.
The concentrated samples were dialyzed overnight at 4

against 20 mmol/L NaAc, pH 5.0, and loaded onto CM-Sepharose Fast Flow
(Pharmacia) column preequilibrated with 20 mmol/L NaAc, pH 5.0. The column was
developed with a linear gradient of NaCl in 20 mmol/L NaAc, pH 5.0. The peak
fractions were pooled and analyzed by SDS-PAGE, followed by Western blot. The
purity of rFL-FL was further measured by ELISA together with spectrophotometer.

1.2.5  Bone marrow colony assays    Bone marrow cells were flushed from the femurs
of 10
15
week-old female BALB/c mice. Cells were first washed once with RPMI 1640 medium
(Gibco, USA) and subjected to separation by Ficoll-Paque (Pharmacia)
density-gradient centrifugation at 1 500 r/min for 30 min. The mononuclear
cells were plated in 24-well plates with 2
×105
cells per well containing 0.5 ml methylcellulose medium. Murine IL-3 (5
mg/L)
and mGM-CSF (2
mg/L)
were supplemented. Different dilution of rFL-FL, as well as standard FL were
prepared for 14 days of incubation at 37

in a CO2 incubator, and colonies mixed (> 40 cells) were
enumerated.

1.2.6  Promotion for survival of starved Raji cells    Raji cells were plated in
96-well plates at 104 cells per well in serum-free RPMI 1640 medium,
or in the presence of 50 and 200
mg/L
of rhFL, or 25
mg/L
of FL-FL fusion protein. After 24, 48, 72, 96 and 120 h, the survived cells
were counted[14].

2  Results

2.1 
Construction of FL-FL fusion protein cDNA

In
order to construct DNA fragment encoding FL-FL fusion protein, two copies of
DNA fragment encoding the soluble domain of FL (1
151
region of the mature peptide) were amplified from FL cDNA by PCR, and connected
by a specially designed linker. In the first copy of FL cDNA (FL-1),
restriction enzyme sites XhoI and HindIII were introduced in
primers FL-1-1 and FL-1-2 for PCR amplification. In order to create the HindIII
site in the reverse primer FL-1-2, the last amino acid Thr (ACA) was changed to
Ser (TCA). The linker consists 45 nucleotides encoding three repeats of
pentapeptide G-G-G-G-S, which is rich in flexibility. Downstream the linker was
the DNA fragment (FL-2) encoding the second FL soluble domain consisting
of 156 amino acids, and followed by a stop codon. Restriction site BamHI
and XbaI were introduced in primer FL-2-1 and FL-2-2 for amplification
of FL-2. FL-1, the linker and FL-2 were cloned and
connected by corresponding restriction enzymes in pSK plasmid. The derived
plasmid was verified by DNA sequencing and named as pSK-FLFL.
The FLFL DNA fragment was introduced to the expression vector
pPICZ
aA
by restriction enzyme XhoI and XbaI to obtain plasmid pPICZ
aA-FLFL.
The schematic features and the DNA sequencing as well as the corresponding
amino acids are shown in Figure 1, and the results of confirmation by
restriction enzyme digestion as well as PCR are shown in Figure 2.

Fig.1  Structure of FL-FL fusion protein cDNA

(A) schematic feature of pPICZaA-FLFL;  (B) DNA sequence in detail.

Fig.2  Confirmation of pPICZaA-FL-FL
by PCR and with restriction endonuclease

M, DNA size markers; 1, 2,  pPICZaA-FLFL
and pPICZ
aA-rhFL
digested by XhoI and XbaI; 3, 4, pPICZ
aA-FLFL
and pPICZ
aA-rhFL
amplified by primers FL-1-1 and FL-2-2.

2.2 
Expression and purification of the rFL-FL

The
SacI-linearized pPICZ
aA-FLFL
was introduced into Pichia pastoris GS115 cells by electroporation.
Colonies grew on the YPD/Zeocin plates were first screened for fusion protein
expression in BMGY medium under induction with methanol as described in
Materials and Methods. Colonies with relatively high expression level of FL-FL
fusion protein were chosen for large-scale expression, and the recombinant
protein was purified from supernatant by the combination of ultrafiltration and
cation-exchange chromatography. The peak fraction eluted at 0.2 mol/L NaCl in
20 mmol/L NaAc (pH 5.0) showed a fuzzy single band of about 43 kD on
SDS-PAGE[Fig.3(A), lane 1], and was confirmed to be rFL-FL fusion protein by
Western blot[Fig.3(B)]. The purity of rFL-FL was tested to be over 90 percent.
Monomeric unglycosylated FL should have a molecular weight of 17.7 kD.
Yeast-produced FL migrated at molecular weight of approximately 20
21
kD. This difference is considered to be due to glycosylation at a single
N-linked site[9].

Fig.3  SDS-PAGE (A) and Western blot (B) analysis of rFL-FL fusion
protein

(A) 1, purified rFL-FL fusion protein; 2,
purified rhFL expressed in Pichia pastoris we reported before[13];  M, protein molecular markers. (B) 1,
negative control;  2, purified
rFL-FL fusion protein.  

2.3 
Effect of rFL-FL on colony formation of bone marrow cells

Since
human FL has the same effect as murine counterpart on mouse hematopoietic
cells, bioassay of rFL-FL was done on colony formation of progenitor cells from
mice bone marrow. As expected, rFL-FL showed higher bioactivity than standard
rhFL expressed in E.coli (Fig.4). The ED50 of rFL-FL was
about 5.2
mg/L
(120 pmol/L), whereas the ED50 of standard rhFL was about 23.0
mg/L
(1 330 pmol/L). Therefore, the purified rFL-FL was at least 10-fold more potent
than rhFL on colony formation.

Fig.4  Effect of rFL-FL and rhFL on colony
formation of mouse bone marrow cells

Total
number of colonies was scored at day 14. Data are expressed as the mean value
of colonies per well (x
±s)
from three duplicated plates.

2.4 
Promotion for survival of starving Raji cells by rhFL and rFL-FL

When
serum is deprived from medium, Raji cells will usually go to apoptosis. It was
reported previously that FL was able to stimulated the proliferation of Raji
cells as a growth factor[15], and the presence of FL will stop
apoptosis of Raji cells. Our result showed that rFL-FL was able to promote the
survival of starving Raji cells at a significantly lower concentration than
rhFL, i.e., 25
mg/L
rFL-FL exhibited almost the same protective effect as 200
mg/L
rhFL (Fig. 5).

Fig.5  Effect of rFL-FL and rhFL on the
survival of Raji cells

Raji cells were incubated in serum-free
medium alone (nil) or in the presence of 50, 200
mg/L
standard rhFL, and 25
mg/L
of purified rFL-FL. The value of survived Raji cells were enumerated at the
time indicated. Data are expressed as the mean number of Raji cells (x
±s)
of five duplicated wells.

3         
Discussion

In
the present study, we have shown that a fusion protein of two human FL soluble
domains linked by a flexible peptide had significantly enhanced bioactivity on
colony formation of bone marrow compared with the conventional monomeric FL.
There are several possible explanations for this observation. First, it may be
due to the increased stability of rFL-FL fusion protein. Second, the enhanced
bioactivity may reflect the increase in receptor affinity. Third, and the more
reasonable possibility, that the binding of one domain of the rFL-FL fusion
protein to its receptor is able to facilitate the binding of the second domain
to its receptor, and thus facilitates the dimerization of the FL receptors. The
study in KL had shown that bivalent binding of the KL provided the driving
force for kit dimerization[16].Covalent dimer of KL exhibited a 10-
to 20-fold increase in bioactivity[17]. FL is considered to have the
same mechanism, i.e., when FL-FL fusion protein is able to enhance the
dimerization of two receptors.

Since
the 3-D structure of FL is not determined at present, the length of the linker
was designed based on the 3-D model by Graddis et al.[9]. The
(GGGGS)3 linker was arbitrarily chosen for its flexibility and also
because it had been used previously in constructing single chain antibodies and
PIXY-321[18], a linked form of human GM-CSF and IL-3 which had
already been used in clinical study. The function of C-terminal amino acids of
FL soluble domain was studied by progressive deletions in detail,[16]
which revealed that the C-terminal amino acid residues from Cys131
were dispensable for its bioactivity. Therefore, FL-1 was designed to be ended
at the 150st amino acid (151st was changed from Thr to Ser), which is 6 amino
acids less compared with FL-2. Both FL-1 and FL-2 are expected to be active.

Several
studies showed that FL promoted the survival of primitive hematopoietic
progenitor cells with myeloid as well as B-cell potential[19,20]. FL
and FL-FL also prevent apoptosis of Raji cells (Burkitt’s lymphomas). The
anti-apoptotic effect of  rhFL and
rFL-FL may be performed through modulation of the appotosis-associated protein
Bcl-2 and Bax[21].

Pichia
pastoris
was used for expression of FL-FL fusion
protein due to the following advantages: secretory expression helps to get
proteins in correct 3-D structure; it secrets very lower level of endogenous
protein but higher level of the expressed protein, which can simplify the
purification of product; it can perform glycosylation; and with very low level
of endotoxin contamination. In order to get high expression of the rFL-FL fusion
protein, cDNA of FL was synthesized by using Pichia pastoris-preferred
codon usage.

Conclusively,
we have successfully construct a human FL-FL cDNA and expressed in Pichia
pastoris
. The rFL-FL fusion protein was stable and higher in bioactivity compared
with conventional FL, and might have a potential clinical application. Other
characteristics of rFL-FL, especially its effect on DCs in vivo, are
being investigated in our laboratory.

References

1  Lyman SD, James L, Vanden Bos T, de Vries
P, Brasel K, Gliniak B, Hollingsworth LT et al. Molecular cloning of a
ligand for the Flt3/flk-2 tyrosine kinase receptor: A proliferative factor for
primitive hematopoietic cells. Cell, 1993, 75(6): 1157
1167

2  Pisarev VM, Parajuli P, Mosley RL, Chavez
J, Zimmerman D, Winship D, Talmadge JE. Flt3 ligand and conjugation to IL-1beta
peptide as adjuvants for a type 1, T-cell response to an HIV p17 gag vaccine. Vaccine,
2002, 20(17-18): 2358
2368

3  Lynch DH, Andreason A, Maraskovsky E,
Whitmore J, Miller RE, Schuh JC. Flt3 ligand induces tumor regression and
anti-tumor immune responses in vivo. Nat Med, 1997, 3(6):
625
631

4  Huang E, Nocka K, Beier DR, Chu TY,
Buck J, Lahm HW, Wellner D et al. The hematopoietic growth factor KL is
encoded by the Sl locus and is the ligand of the c-kit receptor, the gene
product of the W locus. Cell, 1990, 63(1): 225
233

5  Hannum C, Culpepper J, Campbell D,
McClanahan T, Zurawski S, Bazan JF, Kastelein R et al. Ligand for
FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem
cells and is encoded by variant RNAs. Nature, 1994, 368(6472):
643
648

6  Lyman SD, James L, Johnson L, Brasel K,
de Vries P, Escobar SS, Downey H et al. Cloning of the human homologue
of the murine Flt3 ligand: A growth factor for early hematopoietic progenitor
cells. Blood, 1994, 83(10): 2795
2801

7  Arakawa T,Yphantis DA, Lary JW, Narhi
LO,Lu HS,Prestrelski SJ,Clogston Cl et al. Glycosylated and
unglycosylated recombinant-derived human stem cell factors are dimeric and have
extensive regular secondary structure. J Biol Chem, 1991, 266:
18942
18948

8  Williams LT. Signal transduction by the
platelet-drived growth factor receptor involves association of the receptor
with cytoplasmic molecules. Clin Res, 1989, 37(4): 564
568

9  Graddis TJ, Brasel K, Friend D,
Srinivasan S, Wee S, Lyman SD, March CJ et al. Structure-function
analysis of FLT3 ligand-FLT3 receptor interaction using a rapid function
screen. J Biol Chem, 1998, 273(28): 17626
17633

10  Brasel K, McKenna HJ, Morrissey PJ,
Charrier K, Morris AE, Lee CC, Williams DE et al. Hematologic effects of
Flt3 ligand in vivo in mice. Blood, 1996, 88: 2004
2012

11  Pulendran B, Banchereau J, Burkeholder
S, Kraus E, Guinet E, Chalouni C, Caron D et al. Flt3-ligand and
granulocyte colony-stimulating factor mobilize distinct human dendritic cell
subsets in vivo. J. Immunol, 2000, 165: 566
572

12  Juan TS, McNiece IK, Van G, Lacey D,
Hartley C, McElroy P, Sun Y et al. Chronic expression of murine Flt3
ligand in mice results  in
increased circulating white blood cell levels and abnormal cellular infiltrates
associated with splenic fibrosis. Blood, 1997, 90(1): 76
84

13  Xu ZX, Zhu JK, Zhang ZH, Li Y, Lu Y,
Huang WD, Zhang XG. Expression of human Flt3 ligand in Pichia pastoris
and its biological characteristics. Acta Biochim Biophys Sin, 2000, 32(3):
217
222

14  Meyer C, Drexler HG. FLT3 ligand
inhibits apoptosis and promotes survival of myeloid leukemia cell lines. Leuk
Lymphoma
, 1999, 32(5-6): 577
581

15  Xu Z, Xu Y, Zhu J. Expression of recombinant
human soluble Flt3 ligand and its effects on malignant hematopoitic cells. Zhonghua
Xue Ye Xue Za Zhi
, 2000, 21(11): 595
599

16  Lemmon MA, Pinchasi D, Zhou M, Lax I,
Schlessinger J. Kit receptor dimerization is drived by bivalent of stem cell factor.
J Biol Chem
, 1997, 272(10): 6311
6317

17  Nocka KH, Levine BA, Ko JL, Burch PM,
Landgraf BE, Segal R, Lobell R. Increased growth promoting but not mast cell
degranulation potential of a covalent dimer of c-Kit ligand. Blood,
1997, 90(10): 3874
3883

18  Curtis BM, Williams DE, Broxmeyer HE,
Dunn J,Farrah T, Jeffery E, Clevenger W et al. Enhanced hematopoietic
activity of human granulocyte/macrophage colony-stimulating factor-interleukin
3 fusion protein. Proc Natl Acad Sci USA, 1991, 88(13): 5809
5813

19  Veiby OP, Jacobsen FW, Cui L, Lyman SD,
Jacobsen SE. The flt3 ligand promotes the survival of primitive hemopoietic
progenitor cells with myeloid as well as B lymphoid potential. Suppression of
apoptosis and counteraction by TNF-alpha and TGF-beta. J Immunol, 1996, 157(7):
2953
2960

20  Muench MO, Roncarolo MG, Menon S, Xu Y,
Kastelein R, Zurawski S, Hannum CH et al. FLK-2/FLT-3 ligand regulates
the growth of early myeloid progenitors isolated from human fetal liver. Blood,
1995, 85(4): 963
972

21  Lisovsky M, Estrov Z, Zhang X, Consoli
U, Sanchez-Williams G, Snell V, Munker R et al. Flt3 ligand stimulates
proliferation and inhibits apoptosis of acute myeloid leukemia cells:
Regulation of Bcl-2 and Bax. Blood, 1996, 88(10): 3987
3997


ReceivedFebruary
28, 2002    Accepted
June
12, 2002

This
work was supported by grants from IAEA Foundation (No.CRP/9/025) and the Nature
Science Foundation of Jiangsu Province(No.BI98100 )

*Corresponding
author: Tel, 86-512-5196902; Fax, 86-512-5194908;  e-mail, [email protected]