https://www.abbs.info e-mail:[email protected] ISSN 0582-9879                                    ACTA BIOCHIMICA et BIOPHYSICA SINICA 2003, 35(1): 27-34                                    CN 31-1300/Q

Expression of Human Papillomavirus Type 6
L1 and L2 Isolated in China and Self Assembly of Virus-like Particles by the
Products

WANG Miao, WANG Li-Liang, CHEN
Lian-Feng, HAN Ye-Hua, ZOU Yu-Hong, SI Jing-Yi, SONG Guo-Xing*

( Institute
of Basic Medical Sciences, Peking Union Medical College and Chinese Academy of
Medical Sciences, Beijing 100005, China )

Abstract      To
study variations of genome late region of human papillomavirus type 6 (HPV-6)
isolated in China and assembling capabilities of the encoded capsid proteins,
HPV-6 L1 and L2 sequences were cloned and used for expression in
Bac-to-Bac baculovirus expression systems (Gibco BRL). Based upon L1 and
L2 overlapping sequence two sequences (GenBank accession number
AY015006, AY015008) of HPV-6 late region (2869 bp long) were assembled and
classified into HPV-6b by phylogenetic analysis. Compared with prototype sequence,
nine point mutations were found, including four missense mutations. L1, instead
of L2, could self-assemble into virus-like particles (VLPs) in Sf9 nucleus.
VLPs self-assembled by L1 alone (L1-VLPs) and by L1 plus L2 (L1+L2-VLPs) were
purified and further characterized. Both types of VLPs were spherical particles
with a diameter of approximately 50 nm. L1+L2 VLPs comprising L1 and L2 in the
molar ratio of≈4:1 possessed
the HPV-6 L1 VLP surface and conformational epitopes. In co-expression assay
with a series of MOI combination of L1 and L2 recombinant
baculoviruses (total MOI=10), existence of L2 of certain level enhanced L1
production by 0.8 fold and VLP production by 3 – 4 folds under experimental
conditions. In conclusion, variation rate of HPV-6 genome late region is less
than 0.28% and the substitutions A to G at position 7081 and G to A at 7099 may
represent region characteristics. The cloned HPV-6 L1 and L2 sequences can be
expressed efficiently in Sf9 cells, and the expressed products (L1 or L1+L2)
can self-assemble into VLPs that resemble naturally occurring virions.

Key words     HPV-6; L1; L2;
baculovirus vector; virus-like particle

Human
papillomaviruses (HPVs) infect cutaneous, genital, and respiratory epithelia in
a tissue-specific manner. Infection with HPVs is widespread in the general
population, and viral infection is closely associated with both benign and
malignant lesions. From over 100 HPV types described^[1], HPV-16 and
18 are strongly associated with high-grade anogenital lesions and invasive
cancers^[2]. HPV-6 and 11, only rarely associated with malignancies,
are causative agents for about 90% of condyloma acuminata, benign lesions of
the genital mucosa, with HPV-6 being detected more often in these lesions than
HPV-11^[3].

Papillomaviruses
are non-enveloped viruses with a double-stranded DNA genome of 7.8 to 8 kb.
Their icosahedral capsid is composed of the major capsid protein L1 and the
minor capsid protein L2. It has been shown that for bovine papillomavirus type
1 (BPV-1) and HPV-1, 72 capsomers, each presumable a pentamer of L1, are
arranged in a T=7 icosahedral lattice to form the virion capsid^[4].
This structure seems to be highly conserved among papillomaviruses. The exact
position of L2 within the capsid and the capsomer is still unknown. Since HPV
virions cannot be propagated easily in vitro, nor obtained in reasonable
quantities from lesions in vivo, it is rather difficult to study the
properties of the capsid proteins and the mechanisms of their assembly into
capsids.

Recombinant DNA
techniques have been developed to assemble synthetic papillomavirus virions.
Using vaccinia virus expression vectors recombined with HPV-16 L1 and L2
genes, Zhou et al.^[5] detected approximately 40 nm particles
which lacked the characteristic morphology of naturally occurring HPV-1 and
BPV-1 particles. Using the more efficient baculovirus system, Kirnbauer et
al.^[6] obtained HPV-16 VLPs self assembled by the L1 or L1+L2
proteins, Rose et al.^[7] obtained HPV-11 VLPs by expression
of L1 in Sf9 cells. As for HPV-6, L1 and L1+L2 VLPs were obtained by expression
in yeast cells^[8,9], and L1 VLPs purified from baculovirus infected
Sf9 cells were used for seroprevalence test^[10]. HPVs isolated from
different regions have variations in L1 ORF, which may affect assembling
ability of the translated products into VLPs. In the present study we reported
HPV-6 late region sequences (including L1 and L2 coding sequences) cloned from
Chinese patients with condyloma acuminatum, demonstrated efficient production
of HPV-6 VLPs by expression of L1 or L1 plus L2 in Sf9
cells, and probed the effects of L2 on L1 expression and on VLP assembly.

1    Materials
and Methods

1.1   Cloning
of HPV-6 L1 and L2 genes

HPV-6 DNA was
isolated from genital wart biopsies (sample J was from Jinzhou, China and
sample X from Xinxiang, China) as previously described^[11], and used
as amplifying template. Fragment DNA encoding L1 and L2 protein of HPV-6 were
generated by PCR with Taq DNA polymerase (Promega). The sense (P1:5′-CCGGATCC_BamHI-AATA₅₇₈₉TGTGGCGGCCTAGCGACAGCA-3′)
and anti-sense (P2:5′-CAGGATCC_BamHIT₇₂₉₁TACCTTTTAGT-TTTGGCGCGCTT-3′)
primer set specific to L1 gene of HPV-6, and the sense (P3:5′-GCAGATCT_BglIIAATA₄₄₂₃TGGCACATAGTAGGGCCCGACGACG-3′)
and antisense (P4:5′-CTAGATCT_BglIIC₅₈₀₂TAGGCCGCCACATCTGAAAAAAATAAGGG-3′)primer
set specific to L2 gene of HPV-6 were synthesized according to the prototype
HPV-6b sequence^[12], and used in the PCR. BamHI and BglII
sites added in the primers are indicated in bold and lower footnote number of a
base shows its position in the prototype genome sequence.

Following gel
purification, the PCR products were cloned into the pGEM-T vector (Promega)
according to the manufacturer’s instructions. The inserted L1 and L2
fragments were sequenced three times (with Big-Dye DNA sequencing reaction kit
from PE and ABI 310 sequencing instrument). Based upon determined upstream
sequences internal sequencing primers (5′-C6205AGGGTTAATGTAGGTATGGA₆₂₂₅-3′
for L1; 5′-A₄₈₁₆CATCCTCTGAAACAACTACCC4837-3′ for L2)
were synthesized and used in the sequencing.

1.2   Construction
of recombinant baculovirus vectors

Bac-to-Bac
baculovirus expression systems (Gibco BRL) was used for gene expression and
detailed methods for baculovirus manipulation were referred to the instruction
manual. In brief, the HPV-6 L1 and L2 genes from clinical sample
J were excised from the recombinant pGEM plasmids by BamHI and BglII
digestion respectively, gel purified, and separately subcloned into the BamHI-cut,
dephosphorylated baculovirus donor plasmid pFastBac I downstream of the
polyhedrin promoter. After characterization by restriction digestion and DNA
sequencing, each of the recombinant plasmids was used to transform DH10Bac.
Through Tn7 transposon-mediated site-specific in vivo transposition
foreign gene expression cassette was integrated into a baculovirus shuttle
vector (bacmid). The recombinant baculovirus DNA was isolated and used for
transfection of Sf9 cells. Recombinant baculoviruses were harvested thereafter
and were purified by plaque screening. The correctness of recombination was
verified by PCR with L1 and L2 gene specific primers and the
suggested sequencing primers (M13/pUC forward and reverse primers) provided in
the bacmid DNA.

1.3   L1
and L2 protein expression assay

Sf9 cells were
incubated at 28 ℃ in TC-100
medium supplemented with 10% fetal bovine serum. For the expression assay, 3×10⁵ Sf9 cells in 0.5 ml
fresh medium were infected with a baculovirus at a multiplicity of infection
(MOI) of 10 in a well of 24-well plate. In the case of coinfection with L1
and L2 recombinant baculoviruses, total MOI was adjusted to 10 (i.e. MOI
of L1-recombinant baculovirus + MOI of L2-recombinant
baculovirus=10). 72 h post-infection (72 hpi), medium was discarded, and cells
were washed twice with phosphate-buffered saline (PBS). After removing the
supernatant thoroughly, 1×SDS-PAGE sample buffer(150 μl per well) was added to each well, the
lysates of each well were transferred to 100 ℃ water bath for 5 min, the denatured samples were clarified by
centrifugation at 8000 r/min for 2 min. Electrophoresis of 20 μl per sample in
discontinuous SDS-PAGE (5％ stacking gel, pH 6.8; 10％ separate gel, pH 8.8) was followed by Coomassie blue R250 staining
or Western blot (ECL Western blot fluorescent detection kit: Amersham
Pharmacia). The stained gels were scanned and quantitatively analyzed with
TotalLab software for protein molecular weight and composition percentage.
Protocol for ECL Western blot fluorescent detection was carried out according
to manufacturer suggestion.

1.4   Antibodies
used in immuno-detection

Mouse anti-HPV-6 L1 VLP monoclonal
antibodies H6C6, H6E51 and H6K57 were kindly provided by Christensen Milton S.
Hershey Medical Center; Rabbit anti-HPV-6 L1-VLP and L2 polyclonal antibodies
were obtained as a gift from Ian H. Frazer at University of Queensland,
Australia and Denise A Galloway at Fred Hutchinson Cancer Research Center,
University of Washington, respectively; Horseradish peroxidase (HRP) conjugated
goat anti mouse/rabbit IgG antibodies and gold-conjugated (10 nm particles)
goat anti rabbit IgG antibody were purchased from Beijing Zhongshan
Biotechnology Co. Ltd.

1.5   Electron
microscopy

A flask (25 cm²)
of infected cells (MOI=10, 72 hpi) were harvested, washed with PBS and
centrifuged at 1000 r/min for 5 min. The cell pellets were fixed in 3.8%
glutaraldehyde in PBS for 24 h at 4 ℃. After fixation, the cells were washed three times in PBS (8 h each
time) at 4 ℃ and
post-fixed with 1% osmium tetroxide for 2 h at 4 ℃. The samples were then dehydrated with acetone of a series of
graded concentration, and embedded in 1 ∶1 acetone-Epon 812 for 30 min at room temperature, further embedded
in Epon 812 overnight at 37 ℃, and then polymerized for 24 h at 60 ℃. Ultrathin sections were cut with LKBIII ultramicrotome, mounted on
copper grids, stained with uranyl acetate and lead citrate, washed, dried and
finally examined under JEM 1010 transmission electron microscope (TEM).

1.6   Production
of virus-like particles (VLPs)

3×10⁷ Sf9 cells were grown
at 28 ℃ as adherent
culture in a 175 cm² flask containing 35 ml TC-100 insect medium
with 10% fetal bovine serum, 100 u/ml penicillin, 100 mg/L streptomycin and
0.25 mg/L amphotericin B. For production of VLPs, 10 flasks of above cell
cultures were infected with L1 recombinant baculovirus at a MOI of 10 or
co-infected with L1 plus L2 recombinant baculoviruses at a MOI of
10 for each baculovirus. After 72 h, the cells were collected, centrifuged at
1000 g for 5 min and washed twice with PBS, and the final pellet was
either stored in liquid nitrogen or processed immediately. The cell pellet was
re-suspended in 10 ml PBS and purification procedure was essentially as
described elsewhere^[6], except that 325 g/L sucrose cushion in PBS
and 307 g/L CsCl in PBS were used in ultracentrifugation of VLPs.

1.7   Electron
microscopy and immunoelectron microscopy of VLPs

Samples to be
assayed for the presence of VLPs were spun onto carbon-coated 300 mesh copper
grids for 30 s, liquid was absorbed off with a paper towel. Negative staining
was performed using routine method. The samples were stained with 2%
phosphotungstic acid for 30 s, dried under light, and were observed under JEM
1010 TEM.

For immunoelectron microscopy, particles
were absorbed onto carbon-coated nickel grids for 10 min in a box with a wet
towel in it, and, after removing liquid, blocked in blocking solution
(1%BSA-PBS) for 10 min, then incubated with a 1/5 dilution of first antibody in
blocking solution at room temperature for 2 h. Rabbit polyclonal antibodies to
HPV-6 L1 or HPV-6 L2 were used. Samples were then washed with blocking
solution, and further incubated at room temperature for 1 h in a 1/25 dilution
of gold-conjugated goat anti-rabbit IgG antibody in blocking solution. After
sequential washing with blocking solution and water, the samples were
negatively stained as above.

1.8   VLP
ELISA

Purified VLP (2
mg/L per well in PBS) were added to wells of Nunc MaxiSorp plates and incubated
at 37 ℃ for 1 h,
then at 4 ℃ overnight.
Following this incubation, plates were rinsed three times with PBS and then
incubated for 1 h at room temperature with 50 μl of blocking agent (5% instant
nonfat dry milk in PBS). Plates were again rinsed three times with PBS, 50 μl
of diluted first antibodies(in 1% instant nonfat dry milk in PBS) was added to
each well, and then plates were incubated at room temperature for 2 h. Naive
mouse serum was used as negative control. The plates were rinsed five times
with PBS, and 50 μl of a HRP-conjugated secondary antibody (1/1000 diluted in
1% instant nonfat dry milk in PBS) was added to each well and then incubated
for 1 h at 37 ℃. The plates
were rinsed 7 times with PBS, and 50 μl of peroxidase substrate buffer [2.43 ml
0.1 mol/L citric acid+2.57 ml 0.2 mol/L Na₂HPO₄+5 ml H₂O+4
mg ortho-phenylenediamine (OPD)+15 μl 30% H₂O₂] was added
and incubated for 5-10 min at 37 ℃. The reaction was terminated by the addition of 50 μl of 2 mol/L H₂SO₄.
The A was measured in a microplate reader at 490 nm.

2    Results

2.1   Sequences
of the cloned L1 and L2

The coding
sequences of HPV-6 L1 or L2 were separately PCR amplified from
clinical biopsies, cloned and sequenced. Basing upon overlapping sequence, L1
and L2 sequences from the same biopsy were assembled into one sequence
of HPV-6 genome late region. Two such sequences (designated as JL2+1 and XL2+1,
GenBank accession number AY015006 and AY015008) were obtained. Phylogenetic
analysis (Fig.1) was performed between the two sequences and the published
corresponding sequences of HPV-6a^[8] and the prototype HPV-6b^[12]
with DNASTAR software (Jotun Hein Method). The cloned sequences were classified
into HPV-6b. Compared with the prototype HPV-6b sequence, overall nucleotide
variation in the late region sequences was less than 0.28%, and variation in L1
ORF and L2 ORF was less than 0.27% and 0.37%, respectively. The
variations are summarized in Table 1.

Fig.1       Phylogenetic
analysis (by Jotun Hein Method) of the clinical isolates of HPV-6 genome late
region (JL2+1 and XL2+1) with prototype HPV-6b (L2+1-6b) and HPV-6a (L2+1-6a)

Table 1   Summary
of variations in the cloned HPV-6 genome late region

Lower footnote number of base shows position in prototype genome
sequence^[12] while upper footnote number indicates position relative
to the first nucleotide in the corresponding ORF, and upper footnote number of amino
acid shows position in the translated protein sequence.

2.2   L1
and L2 protein expression in insect cells

The L1
and L2 coding sequences of XL2+1 were separately used to generate
recombinant baculoviruses, yielding Bac6L1 and Bac6L2, respectively. SDS-PAGE
analysis of total proteins from Sf-9 cells infected with Bac6L1 demonstrated a
novel 54.5 kD protein seen by Coomassie blue staining [Fig. 2 (A2)]. This
protein was not present in BacNR (non-recombinant baculovirus) infected cell
lysate and comigrated with a protein that was immunoreactive with H6C6
monoclonal antibody prepared against HPV-6 L1 [Fig.2(A2′)]. Compared with
BacNR, Bac6L2 infected cell lysate demonstrated a novel 72.0 kD protein in
SDS-PAGE [Fig.2(B2)], which was immuno-reactive with rabbit polyclonal antibody
against HPV-6 L2 [Fig.2(B2′)]. Lower and higher molecular weight
L2-immunoreactive bands were also detected but not detected in control. L1 and
L2 products constituted 6.82% and 5.03% of total cell proteins, respectively.
The expressed L1 and L2 was localized in cell nucleus after synthesis in
cytoplasm(immuno-histochemistry and laser confocal data not shown).

Fig.2       Expression
of L1 and L2 in Sf9 cells and the Western blot analysis

M, protein marker with relative
molecular weight indicated; A1, B1, Sf9 cell infected with BacNR
(non-recombinant baculovirus) as control; A2, Sf9 cell infected with Bac6L1;
B2, Sf9 cell infected with Bac6L2; A1′, A2′, B1′, B2′ are Western blot of A1,
A2, B1, B2, respectively. Arrows indicate the bands of L1 and L2.

2.3   Electron
microscopy of infected Sf9 cells

Electron micrograph of thin section
of Bac6L1 infected Sf9 cells showed distinct VLPs (HPV capsid-like particles)
in the nuclei of the cells [Fig.3(B)]. No such structures were seen in BacNR
and Bac6L2 infected cells [Fig.3(A),(C)]. Baculoviruses were seen in all
infected cell nuclei [Fig.3(A),(B),(C)].

Fig.3       Electron
micrograph of baculovirus-infected Sf9 cells

Note that large amount of VLPs indicated
by upward arrows were assembled in Sf9 cells (nuclei) infected with Bac6L1(B),
but not in those infected with BacNR (A: negative control) or with Bac6L2(C).
Baculoviruses indicated by rightward arrows (for longitudinal section) and
leftward arrows (for cross section) were found in all infected Sf9 cells(A, B
and C). The VL structure was distinguished from baculovirus seen in cross
section in that the VLPs were not surrounded by a membrane-like structure while
baculoviruses were often multiply occluded in a membrane-like structure, and
individual baculovirus (whether or not stained centrally) had a clearer
boundary than VLP.

2.4   Self-assembly
of VLPs by L1 alone or by L1 plus L2

VLPs were purified from large-scale cell
cultures. The band corresponding to VLPs in cesium chloride gradient
ultracentrifugation was indicated in Fig.4. The purified particles were
negatively stained, and examined with TEM [Fig.5(A), (B)]. No significant
ultra-structure difference was observed between L1-VLPs (from Bac6L1 infection)
and L1+L2-VLPs (from Bac6L1+Bac6L2 coinfection). Both types of VLPs were
spherical particles composed of capsomeres. The particle diameter was
approximately 50 nm, which is consistent with the diameter of isolated
papillomavirus virions. Immunoelectron microscopy results showed that L1+L2-VLP
reacted with both rabbit polyclonal antibodies to HPV-6 L1 and to HPV-6 L2
[Fig.5 insets(C), (D)].

Fig.4       The VLP
band(indicated by arrow) in cesium chloride gradient ultracentrifugation

Fig.5       Electron
microscopy and immunoelectron microscopy analysis of VLPs

A, B, VLPs purified from Sf9 cells
infected with Bac6L1 and with Bac6L1 + Bac6L2, respectively. The insets C, D,
immuno-electron microscopy analysis of the VLPs from B with antibodies to HPV6
L1 and L2, respectively.

To further characterize
the VLPs composition, SDS-PAGE and Western blot analysis were carried out. As
Fig.6 demonstrated, both L1-VLP and L1+L2-VLP contained L1 that was
immunoreactive with H6C6 [Fig.6(A”), (B”)], while L1+L2-VLP contained
additional L2 that specifically reacted with HPV-6 L2 antibodies [Fig.6(B’),
(B”)]. These results together with immunoEM showed that the L2 was
incorporated into the L1-formed VLPs when both proteins were simultaneously
expressed. Calculated from the SDS-PAGE gel, the molar ratio of L1 to L2 in
L1+L2-VLPs was about 4:1 under experimental conditions.

Fig.6       SDS-PAGE
and Western blot analysis of the purified VLPs

M, protein marker with relative
molecular weight indicated; A, B, VLPs purified from Sf9 cells infected with
Bac6L1 and with Bac6L1 + Bac6L2, respectively. N’ (N=A, B) is Western blot of N
detected with antibody to HPV 6 L2, and N” is Western blot of N detected
with a mixture of antibody to both HPV 6 L1 and L2. Solid arrows show the bands
of L1 protein and hollow arrows for L2.

As characterized
by ELISA (Fig.7), the L1+L2 VLP was found to be reactive with both H6E51 and
H6K57 (recognizing surface linear epitopes an conformational epitopes of HPV-6
L1 VLP, respectively^[13]), demonstrating the L1+L2 VLP possessed
HPV-6 L1 VLP immuno-reactivities.

Fig.7       L1+L2
VLP immuno-reactivity in ELISA

2.5   Effect
of L2 protein on L1 protein expression and VLP assembly

To determine
interaction between L1 and L2 during expression we co-infected Sf9 cells with
Bac6L1 and Bac6L2 at a series of MOI ratio of Bac6L1 to Bac6L2 (RL1/L2), which
was 100:0, 90:10, 75:25, 50:50, 25:75, 10:90 and 0:100 with total MOI (=10)
constant. As Fig. 8 showed, expression level of L2 increased as Bac6L2 MOI
increased (i.e. RL1/L2 decreased), while L1 level increased initially, highest
at RL1/L2=75:25 (about 0.8 fold more than at RL1/L2=100:0), then dropped as
Bac6L1 MOI decreased (i.e. RL1/L2 decreased).

Fig.8       Expression
level of L1 and L2 protein in the Sf9 cells co-infected by Bac6L1 and Bac6L2
with different infection ratio

Sf9 cells were co-infected at MOI=10 by Bac6L1 and Bac6L2 with
different ratio indicated. In the SDS-PAGE gel image the bands of L1 and L2 are
pointed out. The amount of L1 protein for ratio of 100/0 is arbitrarily taken
as 1, other L1 and L2 bands are calculated, and the relative values of protein
amount are shown in the upper column graph that is vertically corresponding to
the gel lanes.To investigate whether L2 affects VLP assembly, we determined the
amounts of L1-VLP and L1+L2-VLP parallel purified from the same amount of
infected cells (3×108 cells in 10 flasks of 175 cm2). The amounts of L1-VLP and L1+L2-VLP
purified each time were represented by L1 protein and were calculated from
SDS-PAGE of the purified particles with reference to internal BSA standard
(Table 2). Co-infection with Bac6L1 (MOI=10) and Bac6L2 (MOI=5) increased VLP
production by 3-4 folds in comparison with Bac6L1 single infection at MOI of
either 10 or 15.

Table
2   Production of L1-VLP and
L1+L2-VLP from 3×108 infected cells in two parallel experiments

3    Discussion

Caparros-Wanderley
et al.^[11] analyzed the entire L1 nucleotide sequence of 17
clinical isolates of HPV-6 from the London area and found the most frequently
observed substitutions are clustered into three discrete regions: R1 (nt 5920 –
6075), R2 (nt 6590 – 6670) and R3 (nt 7070 – 7230). All of the five synonymous
substitutions were observed in both JL2+1 and XL2+1 (Table 1). In the three
synonymous substitutions in L1 ORF, ACA⁸¹⁰₆₅₉₈→ACT was reported in R2 region by
Caparros-Wanderley, while GAA¹²⁹³₇₀₈₁→GAG and AAG¹³¹¹₇₀₉₉→AAA, belonging to R3 region, were
not reported in Caparros-Wanderley’s work and may represent region
characteristics. The missense substitution TA²⁰⁰₅₉₈₈C→TGC(Tyr⁶⁷→Cys) in L1 ORF of XL2+1 was
also not reported which falls into R1 region. We excluded cloning and
sequencing error by selecting 3 colonies for one insert and by repeating 2
times for a sequencing reaction. A larger sample size is needed to get clearer
knowledge about the nucleotide preference in HPV-6 late region.

In contrast to
the unique band specific to L1 in the Western blot detection of cell lysate
protein [Fig.2 (A2′)], L2 showed several faint bands in addition to the most
intense band at 72.0 kD position [Fig.2 (B2′)]. The bands were specific to L2
protein when compared with the corresponding positions in the control
(non-recombinant baculovirus infected cell lysate). Together with the SDS-PAGE
result [Fig.2 (B2)], in which a clear protein band existed at 72.0 kD position,
we concluded that the multiple faint bands for L2 immunodetection was possibly
due to L2 protein degradation, posttranslational modification, or aggregation
with Sf9 cell endogenous protein. Similar results were reported for HPV-33 L2
expression in insect cells^[14]. It’s worthy to note that the L2
molecules incorporated into L1+L2-VLP possessed a constant apparent molecular
weight (M_r) of 72 kD [Fig.6(B)], which is higher than Mr
deduced from its amino acid sequence (about 51 kD).

Papillomavirus
L1 is able to self-assemble into VLPs when synthesized in eukaryotic cells, but
not in E. coli. L1 synthesized in E. coli assembled into VLPs
only after complex process of denaturing and renaturing, however, the
assembling efficiency was very low (0.02% – 0.04%)^[15]. The ability
to self-assemble into VLPs is different among HPV L1 varients. It was known
that HPV-16 L1 variants differed greatly in the self assembling ability^[16],
even lost the ability^[17]. VLP formation efficiency is mainly
determined by L1 amino acid sequence. However, the effect of necessary aa and
their space situation on VLP formation is still remained to further
investigation.

The molar ratio
of L1 to L2 in the purified L1+L2-VLP was 4:1 with L2 composition in the VLP
higher than that in virions isolated from biopsies(≈10:1)^[18]. The
difference was possibly related with the lack of interaction between capsid
proteins with virus genome DNA in VLP, thereafter lack of assembly constraint.
The MOI ratio of L1 to L2 recombinant baculovirus might also account for the
difference. We used each MOI of 10 because L1 and L2 expression level was high
and approximately equal to each other under this condition, and L2 composition
in L1+L2-VLP varied only a little when MOI ratio differed. The major part taken
by L1 in naturally occurring HPV particles or recombinant VLPs (for example,
100% in L1-VLP) reflects that L1 plays a ‘scaffold’ role and L2 plays a
‘staff-in’ role in virion assembly. In the VLP formation L1 is essential while
L2 is optional. L2 is able to auto-incorporate into L1 VLP at a constant ratio.
In this study we found that L2 protein enhanced L1 protein expression and L1
assembly into VLP.

In this article,
we cloned two HPV-6 late region sequences from Chinese patients, produced HPV-6
VLPs from Sf9 cells by expression of L1 alone and coexpression of L1 and L2,
and investigated the profiles of co-expression of L1 and L2. In particular, the
L1+L2 VLP greatly mimics naturally occurring HPV virions (non-enveloped). The
production of VLPs in large quantity is a first step towards an understanding
of the viral assembly, the identification of the HPV receptor, the analysis of
the mechanism of infection, and possibly the exploitation of DNA/gene delivery
approach based on the VLPs. Such recombinant HPV capsids are also expected to
be used as efficient vaccines against HPV^[19]. In addition, they can
be used to screen infected individuals for the presence of antibodies
recognizing conformational epitopes on viral capsids.

References

1     De
Villiers EM. Papillomavirus and HPV typing. Clin Dermatol, 1997, 15:
199-206

2     Zur
Hausen H. Papillomavirus infections: A major cause of human cancers. Biochim
Biophys Acta, 1996, 1288: F55-F78

3     Fields
BN, Knipe DM, Howley PM eds. Fields Virology, 3rd ed. Philadelphia: Lippincott-Raven
Publishers, 1996, 2077-2109

4     Baker
TS, Newcomb WW, Olson NH, Cowsert LM, Olson C, Brown JC. Structures of bovine
and human papillomaviruses: Analysis by cryoelectron microscopy and
three-dimensional image reconstruction. Biophys J, 1991, 60(6):
1445-1456

5     Zhou
J, Sun XY, Stenzel DJ, Frazer IH. Expression of vaccinia recombinant HPV 16 L1
and L2 ORF proteins in epithelial cells is sufficient for assembly of HPV
virion-like particles. Virology, 1991, 185(1): 251-257

6     Kirnbauer
R, Taub J, Greenstone H, Roden R, Durst M, Gissmann L, Lowy DR et al.
Efficient self-assembly of human papillomavirus type 16 L1 and L1-L2 into
virus-like particles. J Virol, 1993, 67(12): 6929-6936

7     Rose
RC, Bonnez W, Reichman RC, Garcea RL. Expression of human papillomavirus type
11 L1 protein in insect cells: In vivo and in vitro assembly of
viruslike particles. J Virol, 1993, 67(4): 1936-1944

8     Hofmann
KJ, Cook JC, Joyce JG, Brown DR, Schultz LD, George HA, Rosolowsky M et al.
Sequence determination of human papillomavirus type 6a and assembly of
virus-like particles in Saccharomyces cerevisiae. Virology, 1995,
209(2): 506-518

9     Sasagawa
T, Pushko P, Steers G, Gschmeissner SE, Hajibagheri MA, Finch J, Crawford L et
al. Synthesis and assembly of virus-like particles of human
papillomaviruses type 6 and type 16 in fission yeast Schizosaccharomyces pombe.
Virology, 1995, 206(1): 126-135

10    Greer
CE, Wheeler CM, Ladner MB, Beutner K, Coyne MY, Liang H, Langenberg A et al.
Human papillomavirus (HPV) type distribution and serological response to HPV
type 6 virus-like particles in patients with genital warts. J Clin Microbiol,
1995, 33(8): 2058-2063

11    Caparros-Wanderley
W, Savage N, Hill-Perkins M, Layton G, Weber J, Davies DH. Intratype sequence
variation among clinical isolates of the human papillomavirus type 6 L1 ORF:
Clustering of mutations and identification of a frequent amino acid sequence
variant. J Gen Virol, 1999, 80(Pt 4): 1025-1033

12    Schwarz
E, Durst M, Demankowski C, Lattermann O, Zech R, Wolfsperger E, Suhai S et
al. DNA sequence and genome organization of genital human papillomavirus
type 6b. EMBO J, 1983, 2(12): 2341-2348

13    Christensen
ND, Reed CA, Cladel NM, Hall K, Leiserowitz GS. Monoclonal antibodies to HPV-6
L1 virus-like particles identify conformational and linear neutralizing
epitopes on HPV-11 in addition to type-specific epitopes on HPV-6. Virology,
1996, 224(2): 477-486

14    Volpers
C, Schirmacher P, Streeck RE, Sapp M. Assembly of the major and the minor
capsid protein of human papillomavirus type 33 into virus-like particles and
tubular structures in insect cells. Virology, 1994, 200(2): 504-512

15    Zhang
W, Carmichael J, Ferguson J, Inglis S, Ashrafian H, Stanley M. Expression of
human papillomavirus type 16 L1 protein in Escherichia coli: Denaturation,
renaturation, and self-assembly of virus-like particles in vitro. Virology,
1998, 243(2): 423-431

16    Touze
A, El Mehdaoui S, Sizaret PY, Mougin C, Munoz N, Coursaget P. The L1 major
capsid protein of human papillomavirus type 16 variants affects yield of
virus-like particles produced in an insect cell expression system. J Clin
Microbiol, 1998, 36(7): 2046-2051

17    Cason
J, Kambo PK, Jewers RJ, Best JM. Detection of protein aggregates, but not
virus-like particles, when the major (L1) coat protein of a wild-type human
papillomavirus type 16 (HPV-16) is expressed in insect cells. Biochem Soc
Trans, 1994, 22(3): 335S

18    Doorbar
J, Gallimore PH. Identification of proteins encoded by the L1 and L2 open
reading frames of human papillomavirus 1a. J Virol, 1987, 61(9):
2793-2799

19    Lehtinen
M, Dillner J. Preventive human papillomavirus vaccination. Sex Transm Infect,
2002, 78(1): 4-6