Categories
Articles

03052

A New Model of Trispecific Antibody
Resulting the Cytotoxicity Directed against Tumor Cells

SONG Li-Ping, CHENG Ju-Long, WANG Xiang-Bin, ZHANG Zhong, FANG Min,
ZHOU Zhi-Yong, HUANG Hua-Liang*

(
Institute of Genetics and Developmental Biology, the Chinese Academy of
Sciences, Beijing 100101, China )

Abstract        Bispecific
antibodies (BsAb) with specificity to both tumor cells and CD3 molecule were
believed to be promising immunological tools for the therapy with minimal
residual diseases by activating cytotoxic T cells. However, without
costimulatory molecule CD28, the activated T cells tended to apoptosis. In
order to kill tumor cells more efficiently, a recombinant multifunctional
single-chain trispecific antibody (scTsAb), which contains anti-ovarian
carcinoma (OC) scFv, anti-CD3 scFv and VH domain of anti-CD28 antibody, was
constructed and expressed in E. coli 
BL21 Star strain. The scTsAb showed strong binding avidities to membrane
antigen of SK-OV-3 cell, CD3 molecule on Jurkat cell, and recombinant CD28
antigen. It was further demonstrated that this scTsAb could activate peripheral
blood T cells to elicit strong cytotoxicity against SK-OV-3 cells. This new
type of recombinant scFv antibody set up a new technological platform for T
cells based immunotherapy against cancer, especially with the failure on MHC
antigen presentation or absence of costimulating signal.

Key words     trispecific antibody
(TsAb); scFv; ovarian carcinoma (OC); CD3; CD28

According to the
immune surveillance hypothesis, tumor antigens could be the targets for tumor
immune destruction. However, down regulation of anti-tumor immune response in
tumor patients often leads to tumor immune escape[1]. Considerable efforts had
been made to induce efficient immune reaction. One promising strategy was
bispecific antibodies (BsAb) based approaches to retarget effective cells to
mediate cytotoxicity against tumor cells[2,3].

Two strategies
had been introduced so far: firstly, FcγR-bearing effective cells such as
macrophages and NK cells were recruited toward tumor cells using anti-FcγR ×
anti-TAA (tumor associated antigen) antibodies[4], secondly, anti-CD3 ×
anti-TAA antibodies attracted effective T cells to kill tumor cells in coordination
with costimulating signals[5]. The latter strategy was more promising because
it aimed at the activation of T lymphocytes that were highly specific effector
in mediating cytotoxicity. However, according to the 2-signal model of T cell
activation, the effective activation of T cells demanded a “second”
costimulatory signal in addition to triggering TCR-CD3 complex. Anti-CD3
antibody signals via CD3 simulated physiological antigen-TCR/CD3 complex by MHC
concomitant antigen. Costimulatory signals, such as CD28/B7, CD154/CD40,
CD2/CD58, and LFA-1/ICAM-1[6], ensured the optimal T cell activation. The
best-characterized second signal molecule was CD28. Anti-CD28 antibody
resembled CD28 ligands B7-1 and B7-2, which could interact with CD28 to promote
T-cell survival and initiate T-cell clonal expansion and differentiation[7]. By
now, almost all the tumor immunotherapy with CD28 costimulation employed two
forms, either anti-TAA×anti-CD3 bispecific antibody in combination with
anti-TAA×anti-CD28 bispecific antibody[8,9],  or anti-TAA×anti-CD3 bispecific antibody and anti-CD28
antibody conjugate[10].

The development
of BsAb had undergone chemical conjugation period, somatic fusion period and
genetic engineering period[11]. Trispecific antibody (TsAb) had almost undergone
the same route. Using the sulfhydryl-specific cross-linker
o-phenylenedi-maleimide (o-PDM), a chemical conjugated TsAb [F(ab’)3] had been
developed[12,13]. However, the high cost, low efficiency, laborious work and
by-products in producing clinical TsAbs hindered their development. Genetic
engineering approaches offered a new potential means. Recombinant disulfide
stabilized Fab-(scFv)2 TsAbs were built by C-terminal fusion of scFv molecules
to both of the VL-CL (L) and VH-CH1 (Fd) chains in Fab chains, which could be
expressed in mammalian cells[14,15].

Fig.1       Construction,
structure and expression of scTsAb

(A) Intermediate plasmid for construction
pTRI. pUHM1, pALM-Fc/BsAb, pTMF-CD28 pUHM2, pTRI. (B) Structure of psTRI.In the
present study, a recombinant scFv-based TsAb was constructed which combined
activating and costimulating functions within the single chain molecule. In the
scTsAb, anti-OC antigen scFv, anti-CD3 ε chain scFv and VH domain of anti-CD28
antibody were linked by two specifically designed interlinkers. The two
interlinkers were HSA and Fc fragments which were supposed to prolong the
half-life of scTsAb in vivo and perhaps append its complement-dependent
cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC)
functions. The scTsAb could promote the formation of conjugate of the ovarian
carcinoma cell and CD3/TCR complex, juxtaposing CD28 molecule on the surface of
T cell. Cytolytic T cells that could lyse tumor cells in MTT assay were
generated when peripheral blood leukocytes were activated in the presence of
tumor cells and scTsAb. These results demonstrated that scTsAb could delivery
signal 1 and signal 2 in T cells and efficiently boost tumor lysis activity of
T cells. It put forward a new way for powerful CD3-based immunotherapy without
simultaneous administration of other costimulatory molecules.

1    Materials
and Methods

1.1   Antibodies
and cell lines

Anti-CD3
monoclonal antibody was purchased from Wuhan Institute of Biological Products
(Wuhan, China). RhCD28/Fc Chimera, recombinant human CD28 extracellular domain
fused to human IgG1 Fc were products of R&D System Inc. (USA). Protein
prestained markers were purchased from NEB Biolabs. SK-OV-3 and Jurkat cell
lines (human leukemia T cell lymphoblast) were kept by our laboratory. Anti-OC
scFv, anti-OC × anti-CD3 bispecific antibodies were prepared by renaturing and
purifying the inclusion body expressed in E. coli[16].

1.2   Construction
of trispecific antibody

The backbone of scTsAb was obtained via
splicing by overlapping extention (SOE)-PCR method with six oligonucletides P1,
P2, P3, RE1, RE2, RE3 (Table 1). The backbone of scTsAb was cloned into HindIII
and EcoRI sites of pUC19 to yield pUHM1 [Fig.1(A)]. The anti-OC scFv ×
anti-CD3 scFv bispecific antibody coding fragment, cloned from plasmid
pALM-Fc/BsAb[16] with XhoI and BamHI double digestion, was inserted to pUHM1 to
get pUHM2. Finally the fragment containing BsAb and backbone of the scTsAb was
shifted from pUHM2 to pTMF-CD28 (containing VH domain of anti-CD28
antibody)[17] by NdeI and HindIII digestion, Finally the expression vector of
trispecific single chain antibody was constructed, designated as pTRI
[Fig.1(A)]. In order to increase the solubility of TRI, the trispecific
fragment was cloned to plasmid pTRFA[18] by using primer ‘TRI up’ and ‘TRI
down’ (Table 1)  (LA Taq DNA
polymerase).  The orientation was  confirmed by sequencing and this
plasmid was named as psTRI [Fig.1(B)].

Table 1   Primer sequences

Name

Sequence

P1

5′-CCCAAGCTTATGAAATACCTATTGCCTACGGC-3′

P2

5′-GCCCAGGTGAAACTGCCGTGCCGTCCATGTACTCACACCACTGACGGTCTGCCGACCAAATTGGAAGGTGGTGGTGGTTC-3′

P3

5′-CTGCTGGTTCGTTACACCAAGAAAGTACCCCAAGTGTCAACTCCAACTCCTGTAGAGGTCTCAGGTGGTGGTGGTTCTCAT-3′

RE1

5′-CCGGAATTCCATATGAGAACCACCACCACC-3′

RE2

5′-TTCTTGGTGTAACGAACCAGCAGCGCATTCTGGAAAGAACCACCACCACCGGATCC
CTCGAGAGAACCACCACCACCTTCC-3′

RE3

5′-GGCACGGCAGTTTCACCTGGGCCATGGCTGGTTGGGCAGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAGGTATT-3′

TRI
up

5′-CATCACCATCACCATCACCCGTGCCGTCCATGTACTCAC-3’

TRI
down

5′-TTACGGGCAAGGTGGACAAGT-3’

1.3   Confirmation
of the expression of trispecific antibody

E. coli BL21 Star (DE3) (Invitrogen Co., USA) was transformed with pTRI or
psTRI, the cells were cultured to A600
0.4 at 37 in 1 L LB media containing 50 mg/L kanamycin. The culture  was then induced at 30 for 4 h with 0.4 mmol/L  isopropyl-β-D-thiogalactopyranoside(IPTG). The
cells were then harvested by centrifugation at 4000 r/min for 10 min at 4
.The pellets were resuspended
in 100 mL phosphate-buffered saline (PBS), and then lysed by sonication, and
then centrifuged at 10 000 r/min for 30 min to get the supernatant. The
proteins were fractionated by 10% SDS-PAGE and then blotted to nitrocellulose
membrane. Because the scTsAb recombinant proteins, TRI and sTRI for pTRI and
psTRI respectively, contains the c-myc tag for detection, Western blotting was
performed using mouse anti-c-myc antibody (9E10) (SantaCruz, USA) and
horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (Jackson,
USA) as described[19].

1.4   Functional
characterization of trispecific antibody

1.4.1       The
antigen binding assay
     The
antigen binding activities of sTRI to Jurkat cell membrane antigen, SK-OV-3
cell membrane antigen, and rhCD28/Fc antigen were studied by enzyme-linked
immunosorbant assay (ELISA) as described before[19]. Briefly, ELISA was
performed with the antigen immobilized on 96-well plates. The sTRI protein
bound with antigen was detected by mouse anti-c-myc tag 9E10 antibody, followed
by HRP-conjugated goat anti-mouse antibody, incubation with peroxidase
substrate, and finally measurement of absorbance at 490 nm. The supernatant of
expression product of empty vector was set as negative control.

1.4.2       Bridge
FACS (fluorescence activated cell sorting) assay     
       Bridge
FACS analysis was performed as described[20]. Briefly, Jurkat cells was
preactivated with 80 ku/L IL-2 (Institute of Hematology & Hospital of Blood
Diseases, China), 50 μg/L CD3 monoclonal antibody for three days, and then
washed with RPMI-1640 for two times. Jurkat cells were resuspended in RPMI-1640
(pH 6.8) and mixed with FITC(fluorescein isothiocyanate, Sigma) at a final
concentration of 0.5 mg/L. SK-OV-3 were resuspended in RPMI-1640 (pH 7.2) and
mixed with TRITC at a final concentration of 1.5 mg/L. Both  these two kinds of cells were incubated
for 30 min at 37
,
5% CO2, washed twice, and then resuspended in RPMI-1640 (pH 7.2)
independently. The concentration of activated Jurkat cells and SK-OV-3 cells
were adjusted to 2
×109 and 4×108 cells/L, respectively. To demonstrate cross-linking, equal
volumes of FITC labeled activated Junkat cells and TRITC labeled SK-OV-3
cells[21] were mixed at a ratio of 5:1. sTRI lyses supernatant (60 mg/L total
protein) were added to the cells, mixed, and incubated at 37
for 30 min, and then subjected
to FACS analysis. Analysis were per-formed using CellQuest
�j software (Becton, Dickinsin).

1.4.3       In
vitro cytotoxicity assay
      Human
peripheral blood leukocyte cells (PBL) of healthy donors were isolated from
peripheral blood by method of Ficoll density gradient centrifugation, monocyte/macrophage
fraction was depleted by glass adherence method for 2 h at 37
, 5% CO2. SK-OV-3
target cells were plated in 96-well flat-bottom plate and incubated with
different dilutions of supernatant containing sTRI overnight to prepare cell
monolayer bound with antibody. Freshly isolated effector cells (PBL) were added
to the monolayer of tumor cells at appropriate ratios. Plates were incubated at
37
for 72 h.
Other procedures were carried out as described[22].

1.4.4       Morphologic
analysis
     2×102
SK-OV-3 target cells were incubated in 6-well flat-bottom plate overnight.
Effector cells (PBLs) were pretreated with sTRI overnight, washed two times,
and then added into the SK-OV-3 plate with E/T ratio of 20:1. The cells were
co-incubated with appropriate sTRI supernatant for 2 h, 4 h and 10 h,
respectively. The morphology of the cells was investigated.

2    Results

2.1   Construction
of trispecific antibody scTsAb

To express
scTsAb that was composed of partial anti-CD28 (AF336117), anti-CD3 and anti-OC
antibodies, its expression vectors pTRI and psTRI were constructed as shown
in   Fig.1(A,B). The
universally acknowledged flexible glycine-rich sequence (G4S)3 was inserted
between each VH and VL to restrict intra-chain pairing. In order to provide
sufficient flexibility to allow each molecule to bind their respective receptor
simultaneously, interlinker-Fc (NSTYRVVSVLTVLHQDWLNGKEYKCK) and interlinker-HSA
(FQNALLVRYTKKVPQVSTPTPVE-VS) were also introduced. c-myc tag was added for
immunodetection. In psTRI [Fig.1(B)], the scTsAb was co-expressed with FkpA
under the control of the same T7 promoter and lac operator. To avoid wrong
assembling of each antibody in sTRI, the orientation of sTRI was specifically
designed as (anti-OCVH)-(anti-OCVL)-interlinker- (anti-CD3VL)-(anti-CD3VH)-interlinker-anti-CD28VH)
[Fig.1(B)].

2.2   Confirmation
of the expression of trispecifc antibody

Fig.2       SDS-PAGE
(left) and Western blotting (right) of pTRI and psTRI

The molecular weight  was marked at right. The arrows
indicated the band of desired TRI and psTRI (about 84 kD). The loading order in
SDS-PAGE and Western blotting is: 1 and 2, supernatant (S) and pellet (P) of E.
coli cells harboring pTMF; 3 and 4, supernatant and pellet of E. coli cells
harboring pTRI; 5, molecular weight marker (in Western, prestained marker); 6
and 7, supernatant and pellet of E.coli cells harboring psTRI; 8 and 9,
supernatant and pellet of E. coli cells harboring pTRFA vector.

Fig.3       ELISA
result of trispecific antibody sTRI

(A) sTRI-anti-CD28 ELISA assay. 100 μL of
CD28 (1 mg/L) antigen (rhCD28/FcChimera) was coated on ELISA plate overnight, incubated
with different dilution of supernatant of sTRI and control, respectively. sTRI
CD28 stands for lysed supernatant of induced E. coli cells harboring psTRI;
Control CD28, stands for supernatant of induced E. coli cells harboring plasmid
pTRFA. (B) sTRI-anti-CD3 and sTRI-anti-SK-OV-3 ELISA assay. Jurkat and SK-OV-3
cell membrane antigens were prepared by sonication for 80 s and then
centrifugated for 10 min at 12 000 r/min. 100 μL of Jurkat and SK-OV-3 membrane
antigen (100 mg/L) were coated on ELISA plate overnight at 4 °C. Control SKOV,
SK-OV-3 cell membrane antigen was coated and the expression product of pTRFA
was used as the first antibody; sTRI SKOV, SK-OV-3 cell member antigen was
coated and the expression product of psTRI was used as the first antibody;
Control Jurk, Jurkat cell membrane antigen was coated and the expression
product of pTRFA was used as the first antibody; sTRI Jurk, Jurkat cell
membrane antigen was coated and the expression product of psTRI was used as the
first antibody. The original lysed supernatant concentration was 250 mg/L.The
expression result was detected by SDS-PAGE and Western blotting (Fig.2). scTsAb
could be  observed with the
expected molecular weight of 84 
kD. TRI protein accounted for about 4% of the total bacteria protein and
37.67% was in supernatant. In order to obtain large amounts of soluble scTsAb,
FkpA-based co-expression vector psTRI was constructed. The expression profiles
and Western blotting results suggested the chaperone molecule FkpA could
improve the solubility of the scTsAb greatly (Fig.2). The sTRI protein
accounted for about 9.81% of the total bacteria protein and the soluble part of
sTRI reached its 62.63%. Due to its high solubility, sTRI was used in further
experiments.

2.3   Functional
characterization of trispecific antibody

2.3.1       Binding
properties of sTRI
    To
confirm the antigen binding properties of each component in scTsAb, ELISA was
performed as mentioned in materials and method. The results demonstrated that
sTRI had relatively high binding affinities with Jurkat membrane CD3 antigen,
CD28 antigen,  and SK-OV-3 membrane
antigen, respectively,  while the
binding activities of control were relatively low (Fig.3). The results implied
the other ingredients in the supernatant had little effect on the binding of
sTRI to antigens. Besides, the antibody dilution ratio among 1
5 to 180 (about 501.25 mg/L) was optimal in ELISA
assays and the cytotoxicity assay described below got the similar results.

FACS analysis
demonstrated that sTRI could physically cross-link Jurkat cells and ovarian
carcinoma SK-OV-3 cells (Fig.4). CD3+ and CD28+ Jurkat cells were prelabled
with FITC, and SK-OV-3 cells with TRITC, respectively. In a representative
experiment, only in the presence of sTRI, double-positive colored cell
population increased greatly in the FACS analysis [top right quadrant in
Fig.4(A) right], which implied that scTsAb could mediate Jurkat cells’ binding
with tumor cells, whereas in the control experiment with antibody free or
vector, the expression supernatant could not. The percentage of SK-OV-3 that
bound to Jurkat cells in the presence of sTRI was calculated with CellQuest
software to be 92.14%

Fig.4       Bridge FACS
analysis

Bridge FACS analysis of FITC-labled Jurkat
cells and TRITC-labled SK-OV-3 cells in the presence of sTRI lysed supernatant
(12 mg/L). (A) The cells in the upright quadrant represented the cross-linking
of the two different types of cells. (B) SK-OV-3 cells that acquired FITC
fluorescence were a result of binding to T cells. The marker region (M1) stands
for SK-OV-3 cells that linked with FITC labeled T cells. FL1 represented FITC;
FL2, represented TRITC; Auto, the supernatant of vector expression production
was set as negative control.

 compared with 41.43%, 49.82% when antibody free and vector
supernatant were used [Fig.4(B)].

2.3.2       The
cytotoxcity assay of sTRI       
To
further examine the utility of this new trispecific antibody for application in
tumor therapy, MTT based cytotoxicity assay was performed to evaluate the
ability of effector T cells to destroy SK-OV-3 tumor cells in the presence of
scTsAb.  Different from the BsAb
MTT cytotoxicity assay,   the
PBLs used in cytotoxicity assay had not been pre-treated with low dose of IL-2
or anti-CD3 monoclonal antibody. The cytotoxicity results [Fig.5(A)] showed
that the scTsAb has an effective cytotoxicity to tumor cells. sTRI functioned
best at the concentration of about 12 mg/L total bacterial protein and with the
increase of dilution ratio, the killing ratio decreased gradually. So this
concentration was used in further experiments. To confirm the cytotoxicity
against tumor cells effectively, a series of controls have been set: BSCD28
[anti-OC × anti-CD3 bispecific antibody (2.1 mg/L)[16] + anti-CD28 antibody (40
μg/L)], BS [anti-OC-CD3 bispecific antibody (2.1 mg/L)], CD3 (2.8 mg/L)
[Fig.5(B)]. The induced lysate  
supernatant of E. coli cells carrying pTRFA (about 12 mg/L total
bacterial protein) was used as negative control. The supernatant of sTRI (12
mg/L total bacterial protein) had almost the same cytotoxicity behavior as
positive control BSCD28, which is higher than BsAb and CD3 as expected. In
Fig.5(C), the supernatant of sTRI (60 mg/L total bacterial protein) lysed the
tumor cell more efficiently than OCCD3CD28 [anti-OC scFv (4 mg/L), anti-CD3
monoclonal antibody (20 μg/L) + anti-CD28 monoclonal antibody (40 μg/L)], OCCD3
[anti-OC scFv (4 mg/L), anti-CD3 monoclonal antibody (2.8 mg/L)]. The results
showed the scTsAb has strong ability to redirect T cells to kill tumor cells.
Cytotoxicity experiment revealed a correlationship between an increase in
binding ability for SK-OV-3 and the ability of the scTsAb to argument lysis of
SK-OV-3 cells [Fig.3(B), Fig.5(A)]. With the decrease of the binding ability to
ovarian carcinoma, the cytotoxicity mediated by scTsAb decreased. This finding
suggested that with higher affinity to tumor cells, the scTsAb had more time to
adhere to tumor cells and created more chances for the T cells to bind and kill
tumor cells.

Most of the
tumor cells were destroyed within 24 h after exposure to effective cells in the
presence of scTsAb. At E/T ratio of 25
1, after coincubation with

Fig.5       sTRI-mediated
cytotoxicity in vitro

(A) Different concentration of
sTRI-mediated cell death of SK-OV-3 cells by activated human PBL as determined
by MTT assay. Original, 12 mg/L total bacterial protein; Dilution10, 120 mg/L
total bacterial protein; Dilution100, 1.2 mg/L total bacterial protein;
Dilution1000, 0.12 mg/L total bacterial protein. (B) and (C), sTRI-mediated
cytotoxicity with different control. sTRI, stands for anti-CD3
×anti-CD28×anti-OC trispecific antibody Vector control, the lysed
supernatant of E. coli cells carrying plasmid pTRFA
BSCD28, anti-OC × anti-CD3 bispecific antibody anti-CD28 antibody; BS, anti-OC×anti-CD3 bispecific antibody; CD3,
anti-CD3 antibody; OCCD3CD28, anti-OC scFv
anti-CD3 anti-CD28 monoclonal antibody; OCCD3, anti-OC scFv anti-CD3 monoclonal antibody. (D)
Morphology change of SK-OV-3 and Jurkat cells after treated with sTRI for 2 h,
4 h, and 10 h (40×). The lateral arrows indicated the PBLs, the vertical arrows
indicated the SK-OV-3 cells. sTRI for 2 h, SK-OV-3 cells were adhered with
effector T cells forming the wreath; 
when coincubated  for 4 h, T
cells started to lyse SK-OV-3 cells, the profile of SK-OV-3 was blurred; after
10 h coincubation, most of the tumor cells collapsed [Fig.5(D)]. Finally, the
SK-OV-3 cells vanished in the medium, leaving the PBLs alone.

3    Discussion

T-cell based
anti-tumor immunotherapy requires full and efficient T-cell activation[23]. It
is generally accepted that T-cell activation requires two distinct signals.
Signal through the T-cell receptor alone can lead to anergy or
activation-induced cell death (AICD)[24]. Costimulation with CD28 decreases the
probability of lymphocytes apoptosis and prolongs the lifespan of lymphocytes
in vitro[25]. Ligation of CD28 by agonistic antibody has been shown to prevent
AICD of native T cells during primary stimulation[26].

We describe the
antitumor properties of a new class of trispecific antibody. To our knowledge,
it is the first report that a single-chain trispecific antibody can activate
the two signals on T cells simultaneously. An anti-OC, anti-CD3 ε chain and
anti-CD28 composed scTsAb was constructed with the intent of recruiting T cells
to the ovarian tumor cells, where they were activated to destroy the ovarian
carcinoma cells [Fig.5(D)]. The ELISA result and FACS bridge analysis showed
the scTsAb could recognize and bind specifically with ovarian carcinoma member
antigen, CD3 complex and CD28 molecule on T-lymphocytes. In this construction,
anti-CD3 ε chain scFv acts with TCR-CD3 complex, mimics the stimulation of T
cells as an antigen (signal 1), VH domain of anti-CD28 antibody simulates the
B7 molecule expressed on antigen processing cell (APC), interact with CD28 on T
cells (signal 2). The scTsAb set up a bridge between ovarian carcinoma cells
and T cells and created a microenvironment for the T cell activation and T cell
killing effect (Fig.6). The cytotoxicity mediated by sTRI revealed that the
scTsAb functions as scBsAb plus CD28 monoclonal antibody [Fig.5(B)] and was better
than anti-OC scFv plus anti-CD3, anti-CD28 monoclonal antibody [Fig.5(C)].

To ensure
properly and functionally refolding of each antibody within scTsAb, partial
sequences of HSA and Fc were introduced as interlinkers. ELISA and FACS
analysis demonstrated that each antibody within scTsAb refolded correctly.
Poznansky et al.[27] have demonstrated that the stability of HSA conjugated
protein in animal body increased 20
40 times. In the animal test of recombinant single chain BsAb in our
lab, the half-life of the BsAb containing HSA linker elonged to three times
compared with the BsAb without the HSA (unpublished data). To enhance the
solubility of the scTsAb expression in E. coli, FkpA, a heat shock periplasmic
peptidyl-prolyl cis/trans isomerase (PPIase) was introduced, which could
suppress the formation of inclusion bodies[28,29]. The results proved that it
could facilitate the soluble expression of scTsAb greatly when it was
co-expressed with target protein (Fig.2).

Fig.6       Cartoon
model for the role of recombinant scTsAb

(A) In the native condition, with the
costimulation of CD28, the TCR expressed on CTL cell recognized the antigen
peptide-MHC on tumor cell and elicited a signal cascade to active T cell to
attack tumor cell. However this pathway might be disrupted by the deficiency of
tumor antigen expression, MHC I molecule, B7 co-stimulatory signal and antigen
presentation ability of patients. (B) In the modified model, TRI contained anti-tumor
arm to bind to tumor cells, CD3 and CD28 arms to ‘pull’ and active T cells to
attack tumor cells. At the same time, the HSA fragment on TRI molecule could
prolong the half-life-time of sTRI in sera and the Fc fragment on the TCR might
trigger the Fc
γR cell to kill tumor cells too.

In summary, the
multifunctional scTsAb has many advantages. (1) It can bind to cytotoxicity T
cells and tumor cells simultaneously and then active T cell to kill tumor cells
in a highly tumor specific manner. (2) It can initiate and sustain high level
of cytotoxicity reactivity through CD3 and CD28 “two signal” triggering. (3) It
has optimal intermediate molecule size (about 84 kD) which is small enough to
penetrate tumors and large enough to sustain in circulation for an appropriate
period of time. (4) It is genetically engineered to minimize the human
anti-antibody  (mouse Ig) (HAMA)
reaction which has hindered the clinical application of many mouse monoclonal
antibody[30] and easy of manufacturing. It would set up a new approach on the
way to successful elimination of disseminated tumor cells.

References

1     GilBoa
E. How tumors escape immune destruction and what we can do about it. Cancer
Immunol Immunother, 1999, 48(7): 382
385

2     Zhu
Z, Lewis GD, Carter P. Engineering high affinity humanized
anti-p185HER2/anti-CD3 bispecific F(ab’) 2 for efficient lysis of p185HER2
overexpressing tumor cells. Int J Cancer, 1995, 62(3): 319
324

3     Kroesen
BJ, ter Haar A, Spakman H, Willemse P, Sleijfer DT, de Vries EG, Mulder NH et
al. Local antitumor treatment in carcinoma patients with
bispecific-monoclonal-antibody-redirected T cells. Cancer Immunol Immunother,
1993, 37(6): 400
407

4     Valerius
T, Stockmeyer B, van Spriel AB, Graziano RF, van den Herik-Oudijk I, Repp R,
Deo YM et al. FcalphaRI (CD89) as a novel trigger molecule for bispecific
antibody therapy. Blood, 1997, 90(11): 4485
4492

5     Segal
DM, Weiner GJ, Weiner LM. Introduction: Bispecific antibodies. J Immunol
Methods, 2001, 248(1-2): 1
6

6     Salomon
B, Bluestone JA. Complexities of CD28/B7: CTLA-4 costimulatory pathways in
autoimmunity and transplantation. Annu Rev Immunol, 2001, 19: 225
252

7     Sharpe
AH, Freeman GJ. The B7-CD28 superfamily. Nat Rev Immunol, 2002, 2(2): 116
126

8     Holliger
P, Manzke O, Span M, Hawkins R, Fleischmann B, liu QH, Wolf J et al.
Carcinoembryonic antigen (CEA)-specific T-cell activation in colon carcinoma
induced by anti-CD3 × anti-CEA bispecific diabodies and B7 × anti-CEA
bispecific fusion proteins. Cancer Res, 1999, 59(12): 2909
2916

9     Grosse-Hovest
L, Brandl M, Dohlsten M, Kalland T, Wilmanns W, Jung G. Tumor-growth inhibition
with bispecific antibody fragments in a syngeneic mouse melanoma model: The
role of targeted T-cell co-stimulation via CD28. Int J Cancer, 1999, 80(1): 138
144

10    Daniel
PT, Kroidl A, Kopp J, Sturm I, Moldenhauer G, Dorken B, Pezzutto A.
Immunotherapy of B-cell lymphoma with CD3x19 bispecific antibodies:
Costimulation via CD28 prevents “veto” apoptosis of antibody-targeted cytotoxic
T cells. Blood, 1998, 92(12): 4750
4757

11    Kriangkum
J, Xu B, Nagata LP, Fulton RE, Suresh MR. Bispecific and bifunctional single
chain recombinant antibodies. Biomol Eng, 2001, 18: 31
40

12    Tutt
A, Stevenson GT, Glennie MJ. Trispecific F(ab’) 3 derivatives that use
cooperative signaling via the TCR/CD3 complex and CD2 to activate and redirect
resting cytotoxic T cells. J Immunol, 1991, 147(1): 60
69

13    Wong
WM, Vakis SA, Ayre KR, Ellwood CN, Howell WM, Tutt AL, Cawley MI et al.  Rheumatoid arthritis T cells produce Th1
cytokines in response to stimulation with a novel trispecific antibody directed
against CD2, CD3, and CD28. Scand J Rheumatol, 2000, 29(5): 282
287

14    Schoonjans
R, Willems A, Schoonooghe S, Leoen J, Grooten J, Mertens N. A new model for
intermediate molecular weight recombinant bispecific and trispecific antibodies
by efficient heterodimerization of single chain variable domains through fusion
to a Fab-chain. Biomol Eng, 2001, 17(6): 193
202

15    Schoonjans
R, Willems A, Schoonooghe S, Fiers W, Grooten J, Mertens N. Fab chains as an
efficient heterodimerization scaffold for the production of recombinant
bispecific and trispecific antibody derivatives. J Immunol, 2000, 165(12): 7050
7057

16    Fang
M, Zhao R, Li H, Jiang X, Yin CC, Lin Q, Huang HL. Construction and expression
of an anti-human ovarian carcinoma
× anti-human CD3 bispecific single-chain antibody and its refolding
studies. High Technology Letters, 2002, 12(143): 47
50

17    Cheng
JL, Wang XB, Zhang Z, Liu J, Yao XS, Huang HL. A method for construction
reshaping single-domain antibody. Acta Genetics Sinica, 2002, 29(3): 189
195

18    Zhang
Z, Song LP, Fang M, Wang F, He D, Zhao R, Huang HL et al. Overexpression of
bacterial peptidyl-prolylisomerase fkpA markedly improves soluble and
functional production of engineering antibodies in Escherichia coli.
Biotechniques, 2003, Submited

19    Zhang
Z, Li ZH, Wang F, Fang M, Yin CC, Zhou ZY, Lin Q et al. Overexpression of DsbC
and DsbG markedly improves soluble and functional expression of single-chain Fv
antibodies in Escherichia coli. Protein Expr Purif, 2002, 26: 218
228

20    Kriangkum
J, Xu B, Gervais C, Paquette D, Jacobs FA, Martin L, Suresh MR. Development and
characterization of a bispecific single-chain antibody directed against T cells
and ovarian carcinoma. Hybridoma, 2000, 19(1): 33
41

21    Kreutz
FT, Xu DZ, Suresh MR. A new method to generate quadromas by electrofusion and
FACS sorting. Hybridoma, 1998, 17: 267
273

22    Heo
DS, Park JG, Hata K, Day R, Herberman RB, Whiteside TL. Evaluation of
tetrazolium-based semiautomatic colorimetric assay for measurement of human
antitumor cytotoxicity. Cancer Res, 1990, 50(12): 3681
3690

23    Chambers
CA. The expanding world of co-stimulation: The two-signal model revisited.
Trends Immunol, 2001, 22(4): 217
223

24    Daniel
PT, Kroidl A, Cayeux S, Bargou R, Blankenstein T, Dorken B. Costimulatory
signals through B7.1/CD28 prevent T cell apoptosis during target cell lysis. J
Immunol, 1997, 159(8): 3808
3815

25    Levine
BL, Bernstein WB, Connors M, Craighead N, Lindsten T, Thompson CB, June CH.
Effects of CD28 costimulation on long-term proliferation of CD4+ T cells in the
absence of exogenous feeder cells. J Immunol, 1997, 159(12): 5921
5930

26    Boise
LH, Minn AJ, Noel PJ, June CH, Accavitti MA, Lindsten T, Thompson CB. CD28
costimulation can promote T cell survival by enhancing the expression of
Bcl-XL. Immunity, 1995, 3(1): 87
98

27    Poznansky
MJ, Halford J, Taylor D. Growth hormone-albumin conjugates. Reduced renal
toxicity and altered plasma clearance. FEBS. Lett, 1988, 239(1): 18
22

28    Arie
JP, Sassoon N, Betton JM. Chaperone function of FkpA, a heat shock prolyl
isomerase, in the periplasm of Escherichia coli. Mol Microbiol, 2001, 39(1):
199
210

29    Bothmann
H, Pluckthun A. The periplasmic Escherichia coli peptidylprolyl cis,
  trans-isomerase FkpA. I. Increased
functional expression of antibody fragments with and without cis-prolines. J
Biol Chem, 2000, 275(22): 17100
17105

30    Yang
G, Ran YL, Sun LX, Liu J, Yu L, Yang ZH. High expression in CHO cells and
activity of an anti-P185erbB2 mouse/human chimeric antibody. Acta Biochim
Biophys Sin, 2001, 33(1): 87
92


Received: February 17, 2003Accepted: March
24, 2003

This work was supported by a grant from the
National High Technology Research and Development Program of China (863
Program) (No. 863-102-09-04-01)

*Corresponding author: Tel, 86-10-64857285;
Fax, 86-10-64857285; e-mail, [email protected]