Categories
Articles

(03089)QIN Xin-Yu et al.: Gene Involvement in Effect of Erythromycin on diabetic Gastroparesis

Involvement of Dopamine D3 and
Neuropeptide Y Y5 Receptors in Diabetic Gastroparetic Rats without Response to
Erythromycin

QIN Xin-Yu*#, WANG
Zhi-Gang2#, FEI Jian3, LIU Feng-Lin, CUI Da-Fu3,
CHEN Shao-Liang1

(Departments
of General Surgery; 1Department of Nuclear Medicine, Zhongshan Hospital, Fudan
University, Shanghai 200032, China; 2Surgical Department, Shanghai Jiaotong
University Affiliated No.6 Hospital, Shanghai 200233, China
3Institute of Biochemistry and Cell
Biology, Shanghai Institutes for Biological Sciences, the Chinese Academy of
Sciences, Shanghai 200031, China
)

Abstract       
Erythromycin may accelerate gastric emptying in animals and human probably as
an motilin agonist, but its prokinetic effects show obvious individual
disparity. This study was to find the mechanism of this phenomenon. Microarray
analysis was used to screen genes that might be involved in the response of
diabetic gastroparesis rats to erythromycin. It was found that erythromycin accelerated
gastric emptying of diabetic rats with great individual disparity. Through
microarray analysis we screened differential expression genes that might be
involved in the effect of erythromycin. Among 10 genes screened out, dopamine
D3 receptor (DRD3) and neuropeptide Y Y5 receptor (NPYY5) genes were submitted
to RT-PCR quantification and showed consistent results with microarray. It can
be concluded that erythromycin promote gastric emptying of gastroparetic rats;
DRD3 and NPYY5 may be involved in prokinetic action of erythromycin; and
targets other than motilin receptor of erythromycin might exist as prokinetics..

Key words     diabetic gastroparesis erythromycin DNA microarray RT-PCR

Since erythromycin was observed to mimic motilin[1], it
has attracted attention of many investigators because it has been found to
improve delayed gastric emptying of diabetic patients with gastroparesis[2]. It
was demonstrated that erythromycin and its derivatives were nonpeptide motilin
agonists in rabbits and human[3,4]. Erythromycin has been used to treat kinds
of digestive diseases with hypomotility including diabetic gastroparesis.
During the clinical use of this prokinetics, however, we observed a quite
different response varying from markedly effective to no effect at all. Our
finding agrees with those of Tack’s[5], who reported that a premature
propagated phase III was elicited in only three of five patients with diabetic
gastroparesis after intravenous administration of erythromycin. Little is known
about the mechanism of the difference of effects.
The present study was to investigate the effect of erythromycin on gastric
emptying of diabetic rats with gastroparesis, and screen genes with
differential expression that might be involved in different effects of
erythromycin from the aspect of pharmacogenetics.

1    Materials
and Methods

1.1   Materials

70 male
Sprague-Dawley rats were randomly selected from a large population, weighing
250
330 g (mean
282 g). The rats were raised in three or four per cage in a temperature (25 ℃)
and humidity (60%) controlled environment, with free food and water There is
still no recognized standards of gastroparesis that stand for a series of
symptoms due to delayed gastric emptying, so we set up our standards referring
to literature with modification to study the effect of erythromycin on diabetic
rats with delayed gastric emptying[6]. The standard used are as below (Fig.1):
N, normal group; G, one hour retention (R1H) exceeded mean of N group by more
than 60%; E, R1H reduced more than 30% by auto-control after administration of
erythromycin; the remains were admitted to F group. S, negative control, using
same volume of saline in stead of erythromycin.

Fig.1       The scheme for division groups of rats

1.2   Method

1.2.1      
Measurement of liquid gastric emptying      The
simultaneous gastric emptying of liquids was determined scintigraphically. After
anaethesia by continual inhalation of ether, tested rat was placed supine
beneath the detector immediately after infusing 2 ml Intralipid labeled with
100 μCi 99mT c-DTPA through gastric catheter. Simultaneous images
were collected once per minute for one hour. I.v. injection of erythromycin (3
mg/kg) was given to test group while same volume of saline was used for
negative control. Results were presented as R1H.

1.2.2       RNA extraction and microarray hybridization     Total RNA of rat
antrum was prepared using TRizol reagent (Gibcol BRL). We chose a human
receptor-related cDNA gene chip which contains 288 receptor-related genes
CRs, Biostar Genechip Inc.,
Shanghai, China
. 4 pairs of
RNA samples randomly selected from E and F groups were submitted to microarray
hybridization. Same amount of poly(A)
RNA (24 μg) was labeled with Cy3 and Cy5-conjugated dCTP (Amersham
Biosciences) by reverse transcription reaction and hybridized to human
receptor-related gene chip (Cy3 for E group, Cy5 for F group)[7]. cDNA chips
were scanned using Axon GenePix 4000B scanner (Axon Instruments). The relative
fluorescence intensity was measured for each labeled RNA which was normalized
by 40 house-keeping genes. Then the ratio of Cy5 to Cy3 was calculated. Cy5/Cy3
greater than 2 or less than 0.5 suggested significant changes in gene
expression levels. Each RNA sample was labeled and hybridized twice to correct
bias. Imagene 3.0 software was used to compile the overall list of consistently
and significantly changed genes across the multiple hybridizations.

1.2.3       RT-PCR         Total
RNA was treated with DNaseI (Gibco BRL), and converted to cDNA first strand by
random hexamers using SuperscriptⅡ RNase H-RT kit (Gibco BRL). Among 10 genes
with significant changes on expression, the two receptors of dopamine D3 and
neuropeptide Y Y5 were performed by PCR amplification using house-keeping gene
β-actin (βA) as internal control. RT-PCR was performed in 9 samples randomly
from N group and all samples in E, F and S groups. Based on coding sequences,
the following primers were used[8
10](Table 1).

Table 1   Sequence of
primers used in RT-PCR

Genes

Sequence (5′→3)

PCR product (bp)

D3

AGACGTGTGGCACTCATGATC

CTTTGCCTCAGGACTATGTAGA

212

Y5

CCAGGCAAAAACCCCCAGCAC

GGCAGTGGATAAGGGCTCTCA

524

βA

ATCATGTTTGGGACCTTCAACA

CATCTCTTGCTCGAAGTCCA

318

50 μl final
volume for PCR amplification contained same amount of cDNA, each pair of
primers respectively, 2.5 u of Hotstar polymerase (Qiagen). In order to obtain
maximal sensitivity, the number of cycles used for PCR with each primers pair
was optimized according to the amplification curve obtained for every 5 cycles
from 20 to 40 cycles. PCR was performed after predenaturation at 95 ℃(3 min)
for 30 (D3), 28 (Y5) and 25 (βA ) cycles respectively, each cycle consisting of
denaturation at 94 ℃ (1 min), annealing at 60 ℃ (1 min), extension at 72 ℃ (1
min). 10 μl of the RT-PCR products were electrophorezed on 2.0% agarose gels in
0.5×TAE buffer. To exclude the possibility of contamination of genomic DNA, RNA
samples treated by RNase were subjected to PCR amplification without RT, and
ddH2O was used as negative control.

Optimal density
measurement of the lanes of the agarose gels was performed by means of a
computer-assisted image analysis system. For each sample, a semiquantitative
approach was used by comparing density value of each lane with that of βA in
the same tissue sample. Data were presented as x±s. Paired t-test and ANOVA was
used to evaluate the difference of the mean value (SPSS 11.0).

2    Results

2.1   Gastric
emptying (GE)

According to the
standard given above, among 55 test rats, 54 become diabetic rats, among which
29 become gastroparetic rats, 9 use saline injection (G group) for negative
control (S group) and others use erythromycin. Gastric emptying of G group was
slower than N group [R1H: (63.0%±6.8%) vs. (30.0%±4.5%), P
0.01; but became faster after
treatment of erythromycin [(36.0%±3.8%) vs. (42.0%±14.5%), P
0.05. According to the effect of erythromycin gastroparetic rats were
divided into E group (effective), F group (failure) and S group. The results
are shown in Table 2. The difference of improvement (expressed in form of
difference of R1H by self-comparison before and after treatment) between E and
F group is statistically significant [(28.0%±7.5%) vs. (8.0%±5.2%), P
0.01]. As a result, 11 showed
prokinetic effect of erythromycin while 9 showed poor effect. R1H was used as
an index to judge prokinetic effect of this drug. Fig.2 shows gastric emptying
curves of G group rats.

Table 2   Effect of
Erythromycin on R1H

group

Before treatment (%)

After treatment (%)

P

N

30±4.5

32±6.8

0.874

G

63±6.8

42±14.5

0.018*

E

64±6.5

36±3.8

0.001*

F

60±8.4

52±9.5

0.056

S

62±7.8

60±7.6

0.964

Data are
expressed as x±s, *P
0.05.

Fig.2       Gastric emptying curve of N and G group rats

2.2   Microarray
hybridization and RT-PCR

cDNA microarray
analysis revealed total of 10 genes with up-regulation or down-regulation
(Table 3). Among these genes, it was found that dopamine D3 receptor gene and
neuropeptide Y Y5 receptor gene may have some kinds of association with
gastrointestinal motility regulation
which will be discussed later. Microarray hybridization showed that
expression of two genes were upregulated in E group than F group. So two genes
were selected for further confirmation based on semiquantification of RT-PCR
(Fig.3, Table 4).

Table 3   10 genes screened
out with differential expression

Accession
No.

Cy5/Cy3

Gene
description

U70451

0.482

Myleoid
differentiation primary response protein MyD88

D25278

0.092

mRNA for KIAA0036
gene, complete cds

D14689

0.443

mRNA for
KIAA0023 gene, complete cds

NM-002360

0.293

Progesterone
membrane binding protein (PMBP) mRNA

M22333

0.413

Factor VIII
gene L1 element insertion DNA

U28811

0.445

Cysteine-rich
fibroblast growth factor receptor (CFR-1) mRNA

AE000259

0.466

T-cell
receptor alpha delta locus from bases 250472 to 501670

U25441

0.227

Dopamine D3
receptor (DRD3) gene, complete cds

NM-005123

0.422

Nuclear
receptor subfamily 1
NR1H4, mRNA

U94320

0.232

Neuropeptide
Y5 receptor (NPYY5) mRNA, complete cds

Fig.3       Photograph
of RT-PCR of D3 and Y5 receptor in antrum from four group rats

Table
4 RT-PCR results of D3 and Y5 receptors

Receptors

Cycles

E group

F group

N group

S group

D3

30

0.26±0.04

0.16±0.04

0.21±0.06

0.23±0.06

Y5

28

0.94±0.10

0.68±0.09

0.80±0.18

0.82±0.15

Semi-quantification
analysis of expression of D3 and Y5 receptors in rat antrum. All Data are
expressed as x±s of ratios between each receptor and β-actin in the same tissue
sample. P value between E and F group for both D3 and Y5 are 0.001.
There is no statistical difference in any other comparison between groups.

3    Discussion

With the development of pharmacogenomics, it has been known that
efficacy of many drugs are due to different gene expression profiles coding
their targets, transportor or enzymes.

Our findings are
in accordance with those of previous studies that erythromycin has prokinetic
effect on gastroparesis[11]. This is the first time to report effect of
erythromycin on gastroparetic rats in vivo. It is consistent with in vitro study
of Soulie et al.[12], in which he confirmed contractile effect of erythromycin
on antral smooth muscle cells in STZ induced diabetic rats. We found that small
dose (3 mg/kg) of erythromycin could markedly improve gastric emptying of
diabetic rats with gastroparesis. The responses do have remarkable difference
among diabetic rats. There is no effect on some rats while there is significant
prokinetic effect on the others. These results prompted us to do further study
on differential displaying of receptor-related genes that might be involved in
the phenomina. D3 and Y5 receptors were significantly up-regulated in E group
compared with F group. Theoretically, these 2 receptors may have some relations
with gastro-intestinal motility referring to literature as below, and it is the
reason we concentrate our interests on them, and we did not test other 8 genes
yet.

Is D3 dopamine
receptor involved in regulating gastric motility? No study has been focused on
this issue until now. Recent study showed that dopamine D3 receptor in the area
postrema plays an important role in the regulation of emesis. R(+)-7-OH-DPAT, a
selective D3 receptor agonist, elicited nausea and vomiting in ferrets and
dogs[13,14]. From a clinical point of view, dopamine receptor antagonist such
as phenothiazine, butyrophenones and metoclopramide, which have affinity to D2
and D3 ,receptors are used as antiemetic agents. A study on the mechanism of
gastroprokinetic effect of EM523, an erythromycin derivative, found that
dopamine could suppress contactile activity induced by EM523 in dose-dependent
manner. The mechanism through which receptor subtype dopamine exerted this
effect is still unknown. Combined with our results, we hypothesize that
dopamine inhibit gastrointestinal motility through D3 receptor, while
erythromycin is antagonist of this receptor subtype. Rats with up-regulated
dopamine D3 receptor expression show better response to erythromycin. The
factor that induce up-regulation of these genes is still unknown. But we
conclude that this is not an effect due to administration of erythromycin,
because there is no difference between test groups(E and F group) and negative
controls(S group).

Is NPY Y5
receptor related to gastrointestinal motility? Still no answer yet. Actually
there are few reports concerning this question. NPY is a powerful stimulant of
food intake and is proposed to activate a hypothalamic ‘feeding’ receptor,
namely Y5 receptor. Some studies have confirmed that Y5 receptor is involved in
food intake[15]. D-Trp(34)NPY, a potent and selective Y5 receptor agonist has
dramatic effects on food intake, several selective Y5 antagonist, such as JCF
104, JCF109, CGP71683A, L-152 and 804, can all blockade NPY-induced feeding by
Y5 receptor. One possibility is that erythromycin accelerates gastrointestinal
motility as an agonist of Y5 receptor, so diabetic rats with up-regulated Y5
receptor expression have better response to erythromycin. Increased
gastrointestinal motility also may explain more intensive food intake.
We can not identify the targets of erythromycin yet, but the results do suggest
that there might be some kinds of connection between the prokinetic action of
erythromycin and receptor other than motilin receptors, such as DRD3 and NPYY5
receptor. Theoritically, it is possible for a drug to have different targets
under different conditions, and up- or down-regulation of the targets may be
related to different response to a certain drug.

In fact, it is
the first time to identify the presence of D3 DR and NPY Y5 receptors in
stomach. We used human-receptor related gene to hybridize rat genes. From the
view of homology of genes, we believe that the results have some important
indications: the two receptors may be involved in the physiological regulations
of gastro-intestinal activities such as motility.

Our hypothesis
has quite limited foundations. We just aimed to find something involved in the
mechanism underling the distinction of erythromycin’s prokinetic effect. It is
important to emphasize limitations of this study. A major one is that we used
in vivo study during which differetial gene expression may be affected by many
uncontrolled factors. The second is the unknown effect of erythromycin on the
receptors under study. Despite these limitations, our results should encourage
further research on this topic. Also, alternative explanations merits
considerations for our results. The relationship between erythromycin and DR D3
and NPY Y5 receptors remains to be determined using multiple methods, for
example, radio-labeled receptor binding study. Further study should be done to
identify the roles of DR D3 and NPY Y5 receptor in stomach.
The conclusions of this study may be summarized as below: (1) Low dose (3
mg/kg) of erythromycin can markedly accelerate liquid gastric emptying of
diabetic rats with gastroparesis. The responses are dramatically individual
discrepancy. (2) Dopamine D3 receptor and neuropeptide Y5 receptor may be
involved in prokinetic effect of erythromycin.

References

1     Itoh
Z, Nakaya M, Suzuki T, Arai H, Wakabayashi K. Erythromycin mimics exogenous
motilin in gastrointestinal contractile activity in the dog. Am J Physiol,
1984, 247(6 Pt 1): G688
G694

2     Janssens
J, Peeters TL, Vantrappen G, Tack J, Urbain JL, De Roo M, Muls E et al.
Improvement of gastric emptying in diabetic gastroparesis by erythromycin.
Preliminary studies. N Engl J Med, 1990, 322(15): 1028
1031

3     Peeters
T, Matthijs G, Depoortere I, Cachet T, Hoogmartens J, Vantrappen G.
Erythromycin is a motilin receptor agonist. Am J Physiol, 1989, 257(3 Pt 1):
G470
G474

4     Satoh
M, Sakai T, Sano I, Fujikura K, Koyama H, Ohshima K, Itoh Z et al. An
erythromycin derivative, is a potent motilin receptor agonist in human gastric
antrum. J Pharmacol Exp Ther, 1994, 271(1): 574
579

5     Tack
J, Janssens J, Vantrappen G, Peeters T, Annese V, Depoortere I, Muls E et al.
Effect of erythromycin on gastric motility in controls and in diabetic
gastroparesis. Gastroenterology, 1992, 103: 72
79.

6     Yamano
M,.Kamato T, Nagakura Y Miyata K. Effects of gastroprokinetic agents on gastroparesis
in streptozotocin-induced diabetic rats. Naunyn Schmiedebergs Arch Pharmacol,
1997, 356(1): 145
150

7     Derisi
JL, Iyer VR, Brown PO. Exploring the metabolic and genetic controls of gene
expression on a genomic scale. Science
1997, 278: 680686

8     Caronti
B, Calderaro C, Passarelli F, Palladini G, Pontieri FE. Dopamine receptor mRNAs
in the rat lymphocytes. Life Sci
1998, 62(21): 19191925

9     Goumain
M, Voisin T, Lorinet AM, Laburthe M. Identification and distribution of mRNA
encoding the Y1, Y2, Y4, and Y5 receptors for peptides of the PP-fold family in
the rat intestine and colon. Biochem Biophys Res Commun, 1998, 247(1): 52
56

10    Takahashi
N, Nagai Y, Ueno S, Saeki Y, Yanagihara T. Human peripheral blood lymphocytes
express D5 dopamine receptor gene and transcribe the two pseudogenes. FEBS
Lett, 1992, 314(1): 23
25

11    Peeters
TL. Erythromycin and other macrolides as prokinetic agents. Gastroenterology,
1993, 105(6): 1886
1899

12    Soulie
ML, Cros G, Serrano JJ, Bali JP. Impairment of contractile response to
carbachol and muscarinic receptor coupling in gastric antral smooth muscle
cells isolated from diabetic streptozotocin-treated rats and db/db mice. Mol
Cell Biochem, 1992, 109(2): 185
188

13    Yoshikawa
T, Yoshida N, Hosoki K. Involvement of dopamine D3 receptors in the area
postrema in R(+)-7-OH-DPAT-induced emesis in the ferret. Eur J Pharmacol, 1996,
301(1-3): 143
149.

14    Yoshida
N, Yoshikawa T, Hosoki K. A dopamine D3 receptor agonist, 7-OH-DPAT, causes
vomiting in the dog. Life Sci, 1995, 57(21): 347
350

15    Lecklin
A, Lundell I, Paananen L, Wikberg JE, Mannisto PT, Larhammar D. Receptor
subtypes Y1 and Y5 mediate neuropeptide Y induced feeding in the guinea-pig. Br
J Pharmacol, 2002, 135(8): 2029
2037


Received:
March 18, 2003     Accepted:
June 18, 2003

This work was
supported by a grant from the National Natural Science Foundation of China (No.
30070738)

#These two
authors contributed equally to this work

*Corresponding
author: Tel, 86-21-64041990-2663; Fax, 86-21-64038472; e-mail, [email protected]