Categories
Articles

(03100)JIANG Yong et al.:Sequence and Expression of PACAP and GHRH in Grouper

https://www.abbs.info e-mail:[email protected]

ISSN
0582-9879                          
      
        ACTA BIOCHIMICA et
BIOPHYSICA SINICA 2003, 35(9):
864–872                              
     CN 31-1300/Q

Short Communication

Sequence and
Expression of a cDNA Encoding Both Pituitary Adenylate Cyclase Activating
Polypeptide and Growth Hormone releasing Hormone in Grouper (Epinephelus
coioides
)

JIANG Yong, LI Wen-Sheng,
XIE Jun, LIN Hao-Ran
*

(
Institute
of Aquatic Economical Animal & Guangdong Provincial Key Laboratory for
Aquatic Economical Animal, Zhongshan University, Guangzhou 510275, China )

Abstract        Both
pituitary adenylate cyclase activating polypeptide
PACAP and growth hormone-releasing
hormone
GHRH belong to the vasoactive intestinal polypeptide-glucagon-secretin
family. They are encoded on the same gene in vertebrates (birds, amphibian,
fish). Although the gene encoding PACAP and GHRH has been cloned in other fish
species, characterization of this gene in the commercially important grouper (Epinephelus
coioides
) has not been previously reported. In this study, the GHRH/PACAP
cDNA was cloned from grouper hypothalamic tissue. Two cDNA variants of the
GHRH/PACAP precursor gene were identified as a result of alternative splicing,
a long form encoding both PACAP and GHRH and a short form encoding only PACAP.
Both the long and the short forms of the GHRH/PACAP precursor cDNA were
identified in grouper 22 tissues as well as expression in embryos and larvae by
semi-quantitative RT-PCR detection. PACAP / GHRH precursor mRNA was expressed
at a high level in the central nervous system than in several peripheral
tissues. The data presented here provide the report of PACAP/GHRH mRNA
expression in eye and gill tissues in fish. PACAP/GHRH mRNA was expressed in
grouper embryo and all larval stages examined and was expressed at a high level
starting on neurula stage onwards. The result suggests that PACAP/GHRH had an
important role in the development of embryos and larvae, especially in neurula
appearance stage.

Key words     grouper
(Epinephelus coioides); pituitary adenylate cyclase-activating
polypeptide (PACAP); growth hormone-releasing hormone (GHRH); tissue
distribution; semi-quantitative RT-PCR

Pituitary adenylate
cyclase-activating polypeptide (PACAP) was first isolated from ovine
hypothalamic extracts based on its ability to stimulate adenylate cyclase in
rat pituitary cell cultures[1]. Two molecular form of PACAP have
been identified: a 38 amino acids form (PACAP-38) and a form comprised of the
27 N-terminal amino acids of PACAP-38 (PACAP-27)[2]. Evidence
indicates that both forms of PACAP are derived from the same gene and mRNA
precursor[3]. Growth hormone releasing hormone (GHRH) was first
isolated from a human pancreatic tumour that caused acromegaly based on its
ability to stimulate growth hormone release[4, 5]. GHRH is primarily
produced in the hypothalamus and acts on the pituitary to cause the release of
growth hormone from somatotrophs[6]. In addition, GHRH is produced
in peripheral tissues such as the testis and ovary, and in the brain during
development[7
9]. An increase in cAMP is the main
mechanism by which GHRH acts. Both GHRH and PACAP belong to the vasoactive
intestinal polypeptide-glucagon-secretin family. They are encoded on the same
gene in vertebrates (birds, amphibian, fish) as well as in the invertebrate
tunicate[10, 11]. But in mammals, the two peptides are encoded on
separate genes. PACAP is the highly conserved member of this family.
Conservation during the evolution from protochordate to mammals has yield a 96%
amino acid sequence identity between mammalian and tunicate PACAP-27[10].
In contrast, GHRH is only moderately conserved.

The PACAP gene and/or cDNA have
been cloned from human[12
14], sheep[12], rat[15],
mouse[16], chicken[11], frog[17, 18], salmon[19,
20]
, catfish[21], goldfish[22], zebrafish[9]
and tunicate[10]. Recently, using an in vitro cell perifusion
system, PACAP was shown to induce growth hormone (GH) and gonadotropin (GtH)
release from goldfish and common carp pituitary cell in a dose-dependent
manner, suggesting that PACAP may be involved in seasonal regulation of body
growth and reproduction in fish[23, 24].

The groupers (Epinephelus) are
highly priced and popular marine cultured fish in China and Southeast Asia
countries. However, the grouper larvae growth is slow, high mortality may be
occurred in 14
20 days post hatch. In this paper, the coding region of a gene
encoding PACAP and GHRH precursor were synthesized by RT-PCR from total RNA of
the grouper (Epinephelus coioides) hypothalamic tissue, and we also
examined the presence of PACAP and GHRH mRNAs in embryos and changes in its
expression in early development and tissue distribution in the central nervous
system and several peripheral tissues by semi-quantitative RT-PCR. Our research
objective will be further expanded to examine the potential applications of
PACAP in marine aquaculture, in particular, we will focus on the possible use
of gene recombinant PACAP as a new growth-promoting supplement of fish feed and
a new additive of ovalutory agent for induced spawning in the groupers.

1   Materials and
Methods

1.1 Grouper total RNA
extraction and reverse transcriptase-polymerase chain reaction

Total RNA was extracted using Trizol
(Invitrogen/Life Technologies, Burlington, ON) based on the guanidium
thiocyanate-phenol-chloroform method of extraction. The concentration of the
total RNA was estimated by measuring the absorbance at 260 nm. First strand
cDNA was then reverse-transcribed from 5 μg of total RNA using SuperscriptTM
First-Strand Synthesis system (Gibco BRL) following the manufacturers’s
protocol. Two degenerate sense primers and one antisense primer for nested PCR
reaction were used to amplify the internal region of grouper PACAP/GHRH cDNA
(Table 1). The design of these primers was based on the most conserved amino
acid sequences in known teleost PACAP/GHRH. The 50 μl first PCR reaction
mixture consisted of 2 μl first strand cDNA (template), 1.5 μl of 10 μmol/L P1
and P3, 0.8 mmol/L dNTP mix, 1.25 u Taq DNA polymerase (Gibco BRL) in 5 μl of
10× Taq buffer, 0.8 mmol/L MgCl2. PCR was carried out for 3 min denaturation
(94 ℃), followed by 25 cycles of 45 s denaturation (94 ℃), 30 s primer
annealing (55 ℃), 1 min and 30 s primer extension (72 ℃), and a final extension
for 10 min. 1 μl first round PCR product was removed and amplified again under
the same conditions except using P2 instead of P1. PCR products of the expected
size were separated by electrophoresis using a 1.7% agarose gel. The
anticipated band was purified using E.Z.N.A.Gel Extraction Kit (Omega
D2501-02).

Table 1   Primers used in cloning grouper PACAP/GHRH cDNA(5′3′)

(1)
Degenerate primers for cloning the internal region
P1: GCA
GTGAGCACAAGT)(AGTCTAGTAAGAGCGTACT
P2: GA
AGAAGGAAGCGCGAAAGCGCATGCAG
P3: TA
AGC)(AGCCACTAAG)(GCTCGAGCCGTCCTTTG

(2) Primers for cloning the 3-end
Adapter primer (AP): GGCCACGCGTCGACTAGTACTTTTTTTTTTTT-TTTTT
Universal amplification primer (UAP): CUACUACUACUAGGCCACGC-GTCGACTAGTAC
P4: ATTAGATAGAGCCTTGAGGGAAGAT
P5: AGCCCTTATCCAAAAGACATTCAGA

(3) Primers for cloning the 5-end
Abridged anchor primer: GGCCACGCGTCGACTAGTACGGGIIGGGII-GGGIIG
Abridged universal amplification primer (AUAP): GGCCACGCGTCGA-CTAGTAC
P6: CGTCCTTTGTTCCTAACTCTCTGTC
P7: TTCCCAGAACCGCTGCCAGGTATTTP8: TCTTTTGGATAAGGGCTCTGACTCT

(4) mRNA expression primers
P9: CTCGTCTACGGAATCTTAATGCACTA
P10: TTTGTTCCTAACTCTCTGTCT
β-actin F : TCTCCATCCACGTCGGCCAG;
β-actin R : TAAGTGCCCGTGCGAACCTC

3′-RACE reactions were performed
using AP, P4, P5 and UAP (Table 1), the PCR product was extracted, gel purified
as previously described. 5′RACE reactions were done over two rounds. P7 and
AUAP were primers in the first round PCR. In second round reactions, 2 μl of
the first round PCR product was regarded as template while P8 and AUAP as
primers. All PCR reactions ran for 25 cycles with a 10 min extension at 72 ℃ on
the last cycle. Annealing temperatures used for nested PCR was 55 ℃. Each
primer is indicated in Table 1. RACE PCR products were visualized by staining
the gels in ethidium bromide and viewed with the BioRAD Gel Doc 2000. Ligation
into pGEM-T easy vector (Promega, Madison, WI) was performed using the PCR
products isolated from the agarose gels using E.Z.N.A.Gel Extraction Kit
according to the manufacturer’s instructions. DNA was transformed and
processed. After enzyme digestion with Eco RI (TaKaRa, Japan), preparations
with inserts of expected size were sequenced.

Samples of 20 eggs and embryos at
each stage of embryogenesis were pooled and immediately frozen in liquid
nitrogen. Adult grouper, egg, embryo and larvae were obtained from Daya bay
aquaculture center.

1.2 Sequence analysis

DNA sequences were analyzed with
the BLASTn program available from the NCBI internet website. Protein
translations were done and analyzed with the same source and the programs BLASTx
or BLASTp. Multiple alignments of cDNA and amino acid sequences were performed
with the programs CLUSTAL and ALIGN. Phylogenetic analysis was conducted with
the Treeview program and Clustalx with 0.1.

1.3 Tissue distribution

The RT-PCR was validated by
running PCR reactions for different cycles and different concentration to
determine the cycle number and concentration for each gene that generates half
maximal PCR product. After an initial denaturation for 3 min at 94 °C, the
reaction was performed on the Thermal Controller PTC-200 (MJ Research,
Watertown, MA) with the cycling profile of 45 s at 94 °C, 30 s at 45
60 °C, and 90s at 72 °C followed
by a 10 min extension at 72 °C. Primers see Table 1. After the determination of
the cycle number, the PCR reactions were performed with the template
concentration from 50
350 ng. PCR reaction (5 μl) was electrophoresed on agarose gel
containing ethidium bromide to visualize the products and the yield of PCR
products was quantitated with the Gel Doc 2000 (BioRAD).The specificity of the
reactions was confirmed by cloning the PCR products into pGem-T-easy victor and
sequenced. The PCR for β-actin was performed to serve as an internal of control
in mRNA concentration in the RT reaction with the annealing temperature 60 ℃.

Distribution of the grouper
GHRH/PACAPprecursor mRNAs were examined by RT-PCR withprimers P9 and P10 in
embryos and early development. First-strand cDNA was prepared from total RNA by
treated with DNase. PCR conditions were 30 cycles of 94 °C for 90 s, 55 °C for
45 s, and 72 °C for 90 s, followed by a final extension at 72 °C for 10 min.
For an internal control, RT-PCR was performed at the same time with the primer
for grouper β-actin with annealing temperature 60 °C. PCR products were
separated on 1.4% agarose gels containing ethidium bromide and detected under
ultraviolet light with the Gel Doc 2000 (BioRAD) and analyzed with Quantity one
Tutorial-Quantity standards.

2   Results

2.1 Isolation of grouper
GHRH/PACAP precursor cDNA

A single cDNA fragment of 288 bp
was isolated from grouper hypothalamic tissue by nested PCR with P2 and P3. Two
fragments of 351 and 456 bp were isolated with P7 and P8, respectively (Fig.1).
The two products isolated with primers P7 and P8 differed only in their deletion
or retention of exon 4, respectively. One clone containing exon 4 and another
with exon 4 deleted were amplified by 5′ RACE PCR and sequenced. The grouper
precursor cDNA contained a signal peptide from 338
398 bp (120 aa), GHRH from 651785 bp (85128 aa), and PACAP from 792843 bp (131168 aa). Grouper PACAP is
preceded by a dibasic amino acid enzyme processing site (Lys-Arg) and is
followed by a Gly-Arg-Arg processing site which would yield a 38 amino acids
peptide with an amidated C terminus. Processing at a second amidation site
within the PACAP sequence would result in the 27 amino acids PACAP.
Organization of the grouper gene is very similar to that of the channel
catfish. Grouper GHRH is preceded by a threonine with a dibasic Lys-Arg site 3
amino acids upstream and followed by a Lys-Arg site at the C terminus (Fig.2).

 

Fig.1      Results of RT-PCR GHRH/PACAP precursor cDNA
in the hypothalamus of grouper

(A) Precursor cDNA 288 bp
fragment; (B) 3′ RACE PCR production; (C) 5′ RACE PCR production. M, 100 bp
marker; 1, first round PCR; 2, 3, 4, nested PCR.


Fig.2      Nucleotide sequence
of the grouper GHRH/PACAP precursor cDNA and deduced amino acid sequence

The sequence encoding GHRH is
singly underlined and the sequence encoding PACAP is doubly underlined.
Alternate splicing results in the deletion of nucleotides (italics).

2.2 Distribution of
PACAP/GHRH and their precursor’s alternative splicing

Semi-quantity RT-PCR assays were
developed for measuring the levels of expression of PACAP and GHRH. Series of RT-PCR
reactions were performed for PACAP/GHRH and β-actin. The reactions were sampled
at different cycles and concentration and analyzed by electrophoresis. The
cycle number that generates half maximal reaction was chosen for quantitating
the expression of each gene in all the following experiments, i.e. 25 for
β-actin and 30 for PACAP and GHRH, respectively. To further validate the
assays, these cycle numbers were used to amplify serially diluted DNA templates
of PACAP/GHRH. The dose of the half maximal reaction is 250 ng.

Two RT-PCR products were isolated
in brain (Fig.3) and specific peripheral tissues (Fig.4). Sequence analysis
showed that the two bands represent two differently processed mRNA transcripts,
resulting in a long and a short GHRH/PACAP precursor cDNA in which 105 bp are
missing from the shortened sequence. GHRH/PACAP precursor mRNA expression and
alternative splicing were detected in grouper olfactory bulb,telencephalon,
hypothalamus, cerebellum, medulla oblongata, spinal cord, pituitary (Fig.3),
foregut, midgut, hindgut, muscle, ovary, eye, thymus, heart, liver, head
kidney, spleen, kidney,stomach, fat and gill (Fig.4). PACAP/GHRH mRNA was
expressed in grouper embryo and all larval stages examined. It was highly
expressed starting on neurula stage onwards (Fig.5).

Fig.3      Expression of GHRH/PACAP mRNA in the grouper
brain and pituitary as detected by RT-PCR

1, marker; 2, olfactory bulb; 3,
telencephalon; 4, hypothalamus; 5, cerebellum; 6, medulla oblongata; 7, spinal
cord; 8,pituitary; 10
16, β-actin; 9, 17, negative control.



Fig.4
     RT-PCR products from peripheral tissues of grouper amplified to
detect GHRH/PACAP mRNA expression

1, marker; 2, head kidney; 3, heart; 4, liver; 5, spleen; 6,
kidney; 7, ovary; 8, stomach; 9, foregut; 10
17, β-actin; 18, marker; 19, midgut; 20, hindgut; 21, fat;
22, gill; 23, eye; 24, muscle; 25, thymus; 26
32, β-actin.

Fig.5      Expression of GHRH/PACAP mRNA at egg, embryo and larvae

1, marker; 2, unfertilized eggs; 3, fertilized eggs; 4, two-cell;
5, morula stage; 6, blastula stage; 7, gastrula stage; 8, neurula stage; 9,
otolith formation stage; 10, new hatching larve; 11, 1st day post hatch (dhp);
12, 2nd dhp; 13, 3rd dhp; 14, 4th dhp; 15, 5th dhp; 16, 6th dhp; 17
32, β-actin.

2.3 The relationship of the
grouper PACAP/GHRH precursor cDNA to the other animals’

In this study, two cDNA variants
of the GHRH/PACAP precursor gene in grouper were characterized. Comparison of
the grouper PACAP sequence (1
38 aa) reveals an 89% identity with human PACAP (Table 2);
however, grouper GHRH shares only a 52% identity to human GHRH (Table 3). The
sequence of GHRH is only somewhat conserved among fish, and chicken (Table 3).

Table 2   Homology of
grouper PACAP to published amino acid sequences

Identity (%)

Similarity (%)

References

Channel catfish

94

97

[25]

Thai catfish

94

97

[21]

Sockeye salmon

89

97

[19]

Goldfish

74

88

[22]

Zebrafish

92

97

[9]

Frog

86

100

[17]

Chicken

86

97

[11]

Human

89

100

[14]

Sheep

89

100

[12]

Mouse

89

100

[26]

Table 3   Homology of grouper GHRH to published amino acid sequence

Identity (%)

Similarity (%)

References

Channel catfish

64

77

[25]

Thai catfish

64

77

[21]

Sockeye salmon

55

75

[19]

Goldfish

48

73

[22]

Zebrafish

51

73

[9]

Chicken

51

73

[11]

Human

52

75

[14]

Sheep

45

64

[12]

Mouse

52

76

[26]

The comparison of the grouper GHRH/PACAP
precursor cDNA sequence with that of Thai catfish and channel catfish
demonstrates a high degree of homology between these distant relatives. At the
amino acid level, the deduced sequences for the grouper and channel catfish
coding regions are highly identical (Fig.6); Comparison of the grouper PACAP
sequence (1
38 aa) reveals a 94% identity with channel catfish PACAP, grouper
GHRH shares a 66% identity to zebrafish GHRH. Among the five species presented
in Fig.6, alternate splicing has been observed only in grouper, channel catfish
and salmon mRNA transcripts.

Fig.6      Amino
acid alignment of grouper (Epinephelus coioides), channel catfish (I.
punctatus), Thai catfish (C. macrocephalus), zebrafish (D. rerio), and sockeye
salmon (O.nerka) GHRH/PACAP open reading frames

2.4 The phylogenetic
relationship of teleostean GHRH/PACAP with that of other vertebrates

To determine the phylogenetic
relationship of teleostean GHRH/PACAP with that of other vertebrates, 175 amino
acids were compared among channel catfish, Thai catfish, sockeye salmon,
zebrafish, chicken, and frog sequences with the Treeview and Clustalx program.
Analogous sequence from fish GHRH/PACAP, human PACAP, and human GHRH were
included in the phylogenetic analysis to illustrate the possible evolution of
PACAP and GHRH peptides.

The resulting phylogenetic tree
(Fig.7) showed that grouper GHRH/PACAP is more closely related to that of the
channel catfish and Thai catfish than to that of the other species.

Fig.7 Phylogenetic tree of PACAP and GHRH

3   Discussion

3.1 Structure of the
GHRH/PACAP gene

Structural organization of the grouper
GHRH/PACAP precursor gene was determined by comparison to sockeye salmon and
Thai catfish and channel catfish cDNA sequences[20, 21, 25]. The
insertion or deletion of exon 4 in the grouper gene is consistent with the exon
phase in sockeye salmon and channel catfish; however, in Thai catfish alternate
splicing was not detected[21]. As observed in sockeye salmon and
channel catfish, exon 4 deletion from the grouper precursor mRNA transcript
does not change the frame of the downstream amino acid sequence of PACAP[20,25].
The majority of the GHRH sequence is encoded on exon 4, with residues 33
45 being encoded on exon 5[27].
Similar to the GHRH/PACAP precursor in nonmammalian vertebrates, the mammalian
PACAP precursor gene is composed of 5 exons, with the PACAP coding region
located on exon 5[27]. In mammals, however, GHRH is encoded by a
separate gene on a separate chromosome, and the sequence of PACAP related
peptide is encoded on exon 4 of the PACAP precursor[14, 28].

3.2 Expression of the
GHRH/PACAP gene in grouper embryo and larvae

In recent studies on the role of
PACAP have focused on the embryonic brain. In situ hybridization histochemistry
revealed that the PACAP gene is widely expressed in the neural tube of the mouse
at E10.5[29, 30]. PACAP mRNA is found in differentiating neurons,
suggesting that PACAP may control proliferation or differentiation of
neuroblasts during neural tube development. The presence of high concentrations
of PACAP and PACAP receptors in germinative areas of the developing brain
indicates that the peptide may exert important functions during ontogenesis of
the central nervous system. Indeed, in cerebellar granule cells cultured in
conditions promoting apoptosis, PACAP inhibits programmed cell death and
stimulates neurite outgrowth[31
36]. In chick at embryonic days 3,
PACAP mRNA was isolated and sequence from neuroblasts[37]. In rat,
PACAP has been detected as early as embryonic day 14(E14)[38]. In
mice, PACAP mRNA is present at E9.5[29]. In sockeye salmon,
GHRH/PACAP mRNA is expressed at 4 days after fertilization and continues
through to hatching[20]. PACAP/GHRH mRNA was expressed in grouper
embryos and all larval stages examined and expressed at a high level starting
on neurula stage onwards (Fig.5). The expression results suggest that
PACAP/GHRH may play an important role in embryos and larvae.

3.3 Distribution of the
GHRH/PACAP mRNA expression in grouper tissue

The data presented here provide
the report of PACAP/GHRH mRNA expression in eye and gill tissues in fish. The
expression of PACAP mRNA in the retina of the human fetus and the adult rat has
been detected[39
41]. PACAP type I receptor
immunoreactivity and mRNA expression have been identified in the retina of the
rabbit and rat[31, 41]. These findings along with our result of
early and continuous expression, suggest that PACAP/GHRH has a role in the eye.
The function of PACAP or GHRH in gill remains to be elucidated.

We found that PACAP/GHRH mRNA was
expressed in grouper ovary. Gras et al.[42] showed PACAP mRNA was
expressed in the rat ovary during estrus, but not at other stages of the cycle.
The variable PACAP mRNA expression in the adult ovary suggests PACAP expression
in this tissue is regulated by the estrus cycle. PACAP mRNA expression was
detected in the 2-week-old prepubescent ovary, suggesting a role in maturation
of this reproductive organ. PACAP has also been shown to be involved in meiotic
maturation of rat oocytes[43].

In adult grouper, 22 tissues have
GHRH/PACAP mRNA distribution. PACAP / GHRH precursor mRNA showed high levels in
the central nervous system, and lower but significant contents in several
peripheral tissues (Fig.6). Consistent with the distribution in other species,
where PACAP / GHRH precursor mRNA expression has been demonstrated throughout
the central nervous system and in several peripheral tissues[23, 44].
In the central nervous system, PACAP has been regarded as a neurotransmitter
and a neuromodulator, and evidence in fish suggests that it acts as a hypophysiotropic
factor regulating pituitary hormone secretion[21]. PACAP also acts
as a trophic factor in a number of peripheral tissues[44].

References

1     Miyata
A, Arimura A, Dahl RR, Minamino N, Uehara A, Jiang L, Culler MD et al.
Isolation of a novel 38 residue hypothalamic polypeptide which stimulates
adenylate cyclase in pituitary cells. Biochem Biophys Res Commun, 1989, 164:
567
574

2     Miyata
A, Jiang L, Dahl RD, Kitada C, Kubo K, Fujino M, Minamino N et al. Isolation of
a neuropeptide corresponding to the N-terminal 27 residues of the pituitary
adenylate cyclase activating polypeptide with 38 residues (PACAP38). Biochem
Biophys Res Commun, 1990, 170: 643
648

3     Arimura
A, Shioda S. Pituitary adenylate cyclase activating polypeptide (PACAP) and its
receptors: Neuroendocrine and endocrine interaction. Front Neuroendocrinol,
1995, 16: 53
88

4     Guillemin
R, Brazeau P, Bohlen, P, Esch F, Ling N, Wehrenberg WB. Growth
hormone-releasing factor from a human pancreatic tumor that caused acromegaly.
Science, 1982, 218: 585
587

5     Rivier
J, Spiess J, Thorner M, Vale W. Characterization of a growth hormone-releasing
factor from a human pancreatic islet tumour. Nature, 1982, 300: 276
278

6     Mayo KE,
Cerelli GM, Rosenfeld MG, Evans RM. Characterization of cDNA and genomic clones
encoding the precursor to rat hypothalamic growth hormone-releasing factor.
Nature, 1985: 314, 464
467

7     Pescovitz
OH, Berry SA, Laudon M, Ben-Jonathan N, Martin-Myers A, Hsu SM, Lambros TJ et
al. Localization and growth hormone (GH)-releasing activity of rat testicular
GH-releasing hormone-like peptide. Endocrinology, 1990, 127: 2336
2342

8     Bagnato
A, Moretti C, Ohnishi J, Frajese G, Catt KJ. Expression of the growth
hormone-releasing hormone gene and its peptide product in the rat ovary. Endocrinology,
1992, 130: 1097
1102

9     Fradinger
EA, Sherwood NM. Characterization of the gene encoding both growth
hormone-releasing hormone (GRF) and pituitary adenylate cyclase-activating
polypeptide (PACAP) in the zebrafish. Mol Cell Endocrinol, 2000, 165: 211
219

10    McRory
JE, Sherwood NM. Two protochordate genes encode pituitary adenylate
cyclase-activating polypeptide and related family members. Endocrinology, 1997,
138: 2380
2390

11   McRory JE, Parker
RL, Sherwood NM. Expression and alternative processing of a chicken gene
encoding both growth hormone-releasing hormone and pituitary adenylate
cyclase-activating polypeptide. DNA Cell Biol, 1997, 16: 95
102

12   Kimura C, Ohkubo S,
Ogi K, Hosoya M, Itoh Y, Onda H, Miyata A et al. A novel peptide which stimulates
adenylate cyclase: Molecular cloning and characterization of the ovine and
human cDNAs. Biochem Biophys Res Commun, 1990, 166: 81
89

13   Ohkubo S, Kimura C,
Ogi K, Okazaki K, Hosoya M, Onda H, Miyata A et al. Primary structure and
characterization of the precursor to human pituitary adenylate cyclase
activating polypeptide. DNA Cell Biol, 1992, 11: 21
30

14   Hosoya M, Kimura C,
Ogi K, Ohkubo S, Miyamoto Y, Kugoh H, Shimizu M et al. Structure of the human
pituitary adenylate cyclase activating polypeptide (PACAP) gene. Biochim
Biophys Acta, 1992, 1129: 199
206

15   Ogi K, Kimura C,
Onda H, Arimura A, Fujino M. Molecular cloning and characterization of cDNA for
the precursor of rat pituitary adenylate cyclase-activating polypeptide (PACAP).
Biochem Biophys Res Commun, 1990, 173: 1271
1279

16   Miyata A, Sato K,
Hino J, Tamakawa H, Matsuo H, Kangawa K. Rat aortic smooth-muscle cell
proliferation is bidirectionally regulated in a cell cycle-dependent manner via
PACAP/VIP type 2 receptor. Ann N Y Acad Sci, 1998, 865: 73
81

17   Alexandre D, Vaudry
H, Jegou S, Anouar Y. Structure and distribution of the mRNAs encoding
pituitary adenylate cyclase-activating polypeptide / growth hormone-releasing hormone-like
peptide in the frog, Rana ridibunda. J Comp Neurol, 2000, 421: 234
246

18   Hu Z, Lelievre V,
Tam J, Cheng JW, Fuenzalida G, Zhou X, Waschek JA. Molecular cloning of growth
hormone- releasing hormone / pituitary adenylate cyclase activating polypeptide
in the frog Xenopus laevis brain distribution and regulation after castration.
Endocrinology, 2000, 141: 3366
3376

19   Parker DB, Coe IR,
Dixon GH, Sherwood NM. Two salmon neuropeptides encoded by one brain cDNA are
structurally related to members of the glucagon superfamily. Eur J Biochem,
1993, 215: 439
448

20   Parker DB, Power
ME, Swanson P, Rivier J, Sherwood NM. Exon skipping in the gene encoding
pituitary adenylate cyclase-activating polypeptide in salmon alters the
expression of two hormones that stimulate growth hormone release.
Endocrinology, 1997, 138: 414
423

21   McRory, JE, Parker
DB, Ngamvongchon S, Sherwood NM. Sequence and expression of cDNA for pituitary
adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing
hormone (GHRH)-like peptide in catfish. Mol Cell Endocrinol, 1995, 108: 169
177

22   Leung MY, Tse LY,
Yu KL, Chow BK, Wong AO. Molecular cloning and tissue distribution of pituitary
adenylate cyclase activating polypeptide (PACAP) in the goldfish. Kwon HB, Joss
JMP, Ishii S eds. Rec Progr Mol Comp Endocrinol, Chonnam National University,
Republic of Korea: HRC Press, 1999, 383
388

23   Wong AO, Li WS, Lee
EK, Leung MY, Tse LY, Chow BK, Lin HR et al. Pituitary adenylate cyclase
activating polypeptide as a novel hypophysiotropic factor in fish. Biochem Cell
Biol, 2000, 78: 329
343

24   Xiao D, Chu MM, Lee
EK, Lin HR, Wong AO. Regulation of growth hormone release in common carp
pituitary cells by pitutiary adenylate cyclase-activating polypeptide: Signal
transduction involves cAMP and alcium-dependent mechanisms. Neuroendocrinology,
2002, 76:325
338

25   Small BC, Nonneman
D. Sequence and expression of a cDNA encoding both pituitary adenylate cyclase
activating polypeptide and growth hormone-releasing hormone-like peptide in
channel catfish (Ictalurus puntctatus). Gen Comp Endocrinol, 2001, 122: 354
363

26   Yamamoto K,
Hashimoto H, Hagihara N, Nishino A, Fujita J, Matsuda T, Baba A. Cloning and
charaterization of the mouse pituitary adenylate cyclase-activating polypeptide
(PACAP) gene. Gene, 1998, 211: 63
69

27   Montéro M, Yon L,
Kikuyama1 S, Dufour SS, Vaudry H. Molecular evolution of the growth
hormone-releasing hormone/pituitary adenylate cyclase-activating polypeptide
gene family. Functional implication in the regulation of growth hormone
secretion. J Mol Endocrinol, 2000, 25: 157
168

28   Perez Jurado LA,
Phillips JA Ⅲ, Summar ML, Mao J, Weber JL, Schaefer FV, Hazan J et al. Genetic
mapping of the human growth hormone-releasing factor gene (GHRF) using two
intragenic polymorphisms detected by PCR amplification. Genomics, 1994, 20: 132
134

29   Shuto Y, Uchida D,
Onda H, Arimura A. Ontogeny of pituitary adenylate cyclase activating
polypeptide and its receptor mRNA in the mouse brain. Regul Pept, 1996, 67: 79
83

30   Waschek JA,
Casillas RA, Nguyen TB,DiCicco-Bloom EM, Carpenter EM, Rodriguez WI. Neural
tube expression of pituitary adenylate cyclase-activating polypeptide (PACAP)
and receptor: Potential role in patterning and neurogenesis. Proc Nat Acad Sci
USA, 1998, 95: 9602
9607

31   Cavallaro S, Copani
A, D’Agata V, Musco S, Petralia S, Ventra C, Stivala F et al. Pituitary
adenylate cyclase-activating polypeptide prevents apoptosis in cultured
cerebellar granule neurons. Mol Pharmacol, 1996, 50: 60
66

32   Chang JY, Korolev
VV, Wang JZ. Cyclic AMP and pituitary adenylate cyclase-activating polypeptide
(PACAP) prevent programmed cell death of cultured rat cerebellar granule cells.
Neurosci Lett, 1996, 206: 181
184

33   Campard PK,
Crochemore C, René F, Monnier D, Koch B, Loeffler JP. PACAP type I receptor
activation promotes cerebellar neuron survival through the cAMP/PKA signaling
pathway. DNA Cell Biol, 1997, 16: 323
333

34   Gonzalez BJ,
Basille M, Vaudry D, Fournier A, Vaudry H. Pituitary adenylate
cyclase-activating polypeptide promotes cell survival and neurite outgrowth in
rat cerebellar neuroblasts. Neuroscience, 1997, 78: 419
430

35   Villalba M,
Bockaert J, Journot L. Pituitary adenylate cyclase-activating polypeptide
(PACAP-38) protects cerebellar granule neurons from apoptosis by activating the
mitogen-activated protein kinase (MAP kinase) pathway. J Neurosci, 1997, 17: 83
90

36   Vaudry D, Gonzalez
BJ, Basille M, Pamantung TF, Fontaine M, Fournier A, Vaudry H. The
neuroprotective effect of pituitary adenylate cyclase-activating polypeptide on
cerebellar granule cells is mediated through inhibition of the CED3-related
cysteine protease caspase-3/CPP32. Proc Natl Acad Sci USA, 2000, 97: (24):
13390
13395

37   Erhardt NM,
Fradinger EA, Sherwood NM,Gervini LA, Rivier JE. Early expression of pitutiary
adenylate cyclase-activating polypeptide and activation of its receptor in
chick neuroblasts. Endocrinology, 2001, 142: 1616
1625

38   Tatsuno L,
Somogyvari-Vigh A, Arimura A. Developmental changes of pituitary adenylate
cyclase activating polypeptide (PACAP) and its receptor in the rat brain.
Peptides, 1994, 15: 55
60

39   Olianas MC,
Ingianni A, Sogos V, Onali P. Expression of pituitary adenylate
 cyclase-activating polypeptide
(PACAP) receptors and PACAP in human fetal retina. J Neurochem, 1997, 69: 1213
1218

40   Hannibal J, Ding
JM, Chen D, Fahrenkrug J, Larsen PJ, Gillette MU, Mikkelsen JD. Pituitary
adenylate cyclase-activating peptide (PACAP) in the retinohypothalamic tract: A
potential day-time regulator of the biological clock. J Neurosci, 1997, 17:
2637
2644

41   Seki T, Shioda S,
Izumi S, Arimura A, Koide R. Electron microscopic observation of pituitary
adenylate cyclase-activating polypeptide (PACAP)-containing neurons in the rat
retina. Peptides, 2000, 21: 109
113

42   Gras S, Hannibal J,
Georg B, Fahrenkrug J. Transient periovulatory expression of pituitary
adenylate cyclase-activating peptide in rat ovarian cells. Endocrinology, 1996,
137: 4779
4785

43   Apa R, Lanzone A,
Mastrandrea M, Miceli F, Macchione E, Fulghesu A, Caruso A et al. Effect of
pituitary adenylate cyclase-activating polypeptide on meiotic maturation in
follicle-enclosed, cumulus-enclosed, and denuded rat oocytes. Biol Reprod,
1997, 57: 1074
1079

44   Arimura A. Perspectives
on pituitary adenylate cyclase activating polypeptide (PACAP) in the
neuroendocrine, endocrine, and nervous systems. Jpn J Physiol, 1998, 48: 301
331

_______________________________________

Received: March 27, 2003     Accepted: June 23, 2003
This work was supported by the grants from the National High Technology
Research and Development Program of China (863 Program) (No. 2001AA621110, No.
2001AA621010), the National Natural Science Foundation of China (No. 39970586)
and Guangdong Natural Science Foundation (No. 20023002)

* Corresponding author: Tel,
86-20-84113791; e-mail, [email protected]